\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004372036:

Variant ID: vg1004372036 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4372036
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCTCCAGTATTCGATGTGTTACGTCCAACCCAAGTCTATCCACAAGCACCGATCCAGCACCTTCCGCCACAAGCTACGCAAGTGCCAGTGTGCTTC[G/A,T]
CCGGGCAGCCTTTGATTGCGGTAGTATATCCGGCCCCTCACGCGCAGCTGCAAGCTCAGCCGGTCGCTGCCCAAGCACACTCTCAGCCGCCTGGCCAAGT

Reverse complement sequence

ACTTGGCCAGGCGGCTGAGAGTGTGCTTGGGCAGCGACCGGCTGAGCTTGCAGCTGCGCGTGAGGGGCCGGATATACTACCGCAATCAAAGGCTGCCCGG[C/T,A]
GAAGCACACTGGCACTTGCGTAGCTTGTGGCGGAAGGTGCTGGATCGGTGCTTGTGGATAGACTTGGGTTGGACGTAACACATCGAATACTGGAGGATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 16.10% 1.27% 44.22% T: 0.04%
All Indica  2759 28.40% 16.50% 1.56% 53.57% NA
All Japonica  1512 63.40% 1.40% 0.93% 34.26% NA
Aus  269 1.50% 93.30% 0.00% 5.20% NA
Indica I  595 33.30% 42.50% 0.00% 24.20% NA
Indica II  465 34.60% 10.50% 0.86% 53.98% NA
Indica III  913 20.00% 3.40% 2.85% 73.71% NA
Indica Intermediate  786 30.70% 15.50% 1.65% 52.16% NA
Temperate Japonica  767 82.50% 0.30% 0.13% 17.08% NA
Tropical Japonica  504 32.30% 2.80% 2.18% 62.70% NA
Japonica Intermediate  241 67.60% 2.10% 0.83% 29.46% NA
VI/Aromatic  96 32.30% 19.80% 1.04% 46.88% NA
Intermediate  90 37.80% 18.90% 2.22% 38.89% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004372036 G -> T LOC_Os10g08070.1 missense_variant ; p.Arg171Leu; MODERATE nonsynonymous_codon ; R171L Average:65.608; most accessible tissue: Zhenshan97 flag leaf, score: 88.022 unknown unknown TOLERATED 0.14
vg1004372036 G -> A LOC_Os10g08070.1 missense_variant ; p.Arg171His; MODERATE nonsynonymous_codon ; R171H Average:65.608; most accessible tissue: Zhenshan97 flag leaf, score: 88.022 unknown unknown TOLERATED 0.11
vg1004372036 G -> DEL LOC_Os10g08070.1 N frameshift_variant Average:65.608; most accessible tissue: Zhenshan97 flag leaf, score: 88.022 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004372036 G A 0.01 0.0 -0.01 0.02 0.01 0.02
vg1004372036 G T 0.01 0.0 -0.01 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004372036 1.48E-06 1.48E-06 mr1144 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372036 NA 5.55E-07 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372036 NA 9.34E-06 mr1808 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004372036 3.49E-06 NA mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251