\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004371908:

Variant ID: vg1004371908 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4371908
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.12, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AAACACAGGCCGAAGCCAACATGGAAGCCATGCGACAGAACATGACATGCCTCCAGGACATGCTTCGGCAGATGCAAGAACAGCAGCAAGCGTACGAGGC[A/T]
GCGAGGCGGGCCAAGGCCGCTTCGACCCAATCCTCCAGTATTCGATGTGTTACGTCCAACCCAAGTCTATCCACAAGCACCGATCCAGCACCTTCCGCCA

Reverse complement sequence

TGGCGGAAGGTGCTGGATCGGTGCTTGTGGATAGACTTGGGTTGGACGTAACACATCGAATACTGGAGGATTGGGTCGAAGCGGCCTTGGCCCGCCTCGC[T/A]
GCCTCGTACGCTTGCTGCTGTTCTTGCATCTGCCGAAGCATGTCCTGGAGGCATGTCATGTTCTGTCGCATGGCTTCCATGTTGGCTTCGGCCTGTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 15.70% 0.80% 9.29% NA
All Indica  2759 83.40% 15.80% 0.40% 0.36% NA
All Japonica  1512 71.00% 1.10% 1.32% 26.52% NA
Aus  269 6.70% 92.90% 0.00% 0.37% NA
Indica I  595 57.50% 41.00% 0.84% 0.67% NA
Indica II  465 89.50% 10.30% 0.00% 0.22% NA
Indica III  913 96.40% 3.40% 0.11% 0.11% NA
Indica Intermediate  786 84.40% 14.50% 0.64% 0.51% NA
Temperate Japonica  767 91.30% 0.30% 0.91% 7.56% NA
Tropical Japonica  504 36.90% 2.00% 2.18% 58.93% NA
Japonica Intermediate  241 78.00% 2.10% 0.83% 19.09% NA
VI/Aromatic  96 53.10% 19.80% 4.17% 22.92% NA
Intermediate  90 72.20% 18.90% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004371908 A -> T LOC_Os10g08070.1 synonymous_variant ; p.Ala128Ala; LOW synonymous_codon Average:72.969; most accessible tissue: Zhenshan97 young leaf, score: 90.175 N N N N
vg1004371908 A -> DEL LOC_Os10g08070.1 N frameshift_variant Average:72.969; most accessible tissue: Zhenshan97 young leaf, score: 90.175 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004371908 A T -0.01 0.0 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004371908 2.09E-06 2.09E-06 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004371908 NA 1.46E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004371908 4.87E-06 NA mr1090_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251