Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004348990:

Variant ID: vg1004348990 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4348990
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CAATTTCCTTACTCAAGTGTCCCAGTAGACAAGCTTCTCCGAATTGTTGGCCTGCCAAAAAAAAATTTTAAGTATACGGATACACATTTGAAGTATTAAA[T/C]
GGAAACTAATAACAAGACAAATTACAGATTCTGTGTGTAAATTGTGAGACGAATTTAGTAAGCCTAATTAATCCGTCATTAGCAAATGTTTACTGTAGCA

Reverse complement sequence

TGCTACAGTAAACATTTGCTAATGACGGATTAATTAGGCTTACTAAATTCGTCTCACAATTTACACACAGAATCTGTAATTTGTCTTGTTATTAGTTTCC[A/G]
TTTAATACTTCAAATGTGTATCCGTATACTTAAAATTTTTTTTTGGCAGGCCAACAATTCGGAGAAGCTTGTCTACTGGGACACTTGAGTAAGGAAATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.60% 0.17% 0.23% NA
All Indica  2759 73.40% 26.20% 0.18% 0.25% NA
All Japonica  1512 46.70% 52.80% 0.20% 0.26% NA
Aus  269 5.90% 94.10% 0.00% 0.00% NA
Indica I  595 57.30% 42.20% 0.50% 0.00% NA
Indica II  465 75.50% 23.90% 0.22% 0.43% NA
Indica III  913 79.40% 20.20% 0.11% 0.33% NA
Indica Intermediate  786 77.20% 22.50% 0.00% 0.25% NA
Temperate Japonica  767 25.80% 73.50% 0.39% 0.26% NA
Tropical Japonica  504 81.70% 17.90% 0.00% 0.40% NA
Japonica Intermediate  241 39.80% 60.20% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 58.30% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004348990 T -> C LOC_Os10g08022.1 upstream_gene_variant ; 3481.0bp to feature; MODIFIER silent_mutation Average:76.926; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg1004348990 T -> C LOC_Os10g08026.1 upstream_gene_variant ; 623.0bp to feature; MODIFIER silent_mutation Average:76.926; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg1004348990 T -> C LOC_Os10g08030.1 downstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:76.926; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg1004348990 T -> C LOC_Os10g08026-LOC_Os10g08030 intergenic_region ; MODIFIER silent_mutation Average:76.926; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N
vg1004348990 T -> DEL N N silent_mutation Average:76.926; most accessible tissue: Minghui63 young leaf, score: 86.723 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004348990 T C 0.11 0.05 0.04 0.03 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004348990 NA 5.61E-06 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004348990 4.00E-06 NA mr1658 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004348990 NA 3.19E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004348990 NA 8.13E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004348990 NA 5.73E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251