\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004324027:

Variant ID: vg1004324027 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4324027
Reference Allele: GAlternative Allele: C,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTGGGAGCGATGGGTTGGGGATGGGAGATGAGCAGATAAGGTTGAGGAGAAGGTGTCAGGCTGGGAGGGATTTTAAGGATTTTTTTTTGTAGGCGGT[G/C,T]
CTCTTAACCTCTGCTTGTGAAATTTCATTTTTGCTGACGGTACACTAAGTTGGCCGCCAGCAAAAGGAAATATATTTTCGCTGGCGGTACATTAAGTGGG

Reverse complement sequence

CCCACTTAATGTACCGCCAGCGAAAATATATTTCCTTTTGCTGGCGGCCAACTTAGTGTACCGTCAGCAAAAATGAAATTTCACAAGCAGAGGTTAAGAG[C/G,A]
ACCGCCTACAAAAAAAAATCCTTAAAATCCCTCCCAGCCTGACACCTTCTCCTCAACCTTATCTGCTCATCTCCCATCCCCAACCCATCGCTCCCACTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 19.10% 0.02% 0.00% T: 0.13%
All Indica  2759 98.80% 1.20% 0.00% 0.00% T: 0.07%
All Japonica  1512 46.60% 53.30% 0.00% 0.00% T: 0.07%
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.80% 0.00% 0.00% T: 0.25%
Temperate Japonica  767 12.00% 88.00% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 56.00% 43.60% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 62.50% 33.30% 1.04% 0.00% T: 3.12%
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004324027 G -> C LOC_Os10g08011.1 upstream_gene_variant ; 55.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N
vg1004324027 G -> C LOC_Os10g08014.1 upstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N
vg1004324027 G -> C LOC_Os10g08011-LOC_Os10g08014 intergenic_region ; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N
vg1004324027 G -> T LOC_Os10g08011.1 upstream_gene_variant ; 55.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N
vg1004324027 G -> T LOC_Os10g08014.1 upstream_gene_variant ; 2717.0bp to feature; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N
vg1004324027 G -> T LOC_Os10g08011-LOC_Os10g08014 intergenic_region ; MODIFIER silent_mutation Average:59.745; most accessible tissue: Callus, score: 95.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004324027 NA 6.18E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.69E-23 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 3.06E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 3.64E-06 3.84E-41 mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.11E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.87E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.51E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.14E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 6.67E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.64E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.13E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.39E-07 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.38E-06 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.17E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.11E-42 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.72E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 7.81E-32 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 4.08E-37 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 2.09E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 6.57E-40 mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 3.06E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 2.11E-27 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 1.19E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 2.62E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004324027 NA 9.53E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251