\
| Variant ID: vg1004260807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4260807 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGAAGAATAGAGAAAGAGGGATTGATAAGTGGGCCCATGGGCAAACTTGTCTTTAACCAAAGTCCCTCTCTCCGTTTCGACCGGAAATAATAAAATAATA[A/G]
GAGGAGTGTCTAGCAGCTAATTACCACTTTTTTACAGTGTCTATGAGCAAATACACGATTTTCGGGTATCTTACAGCAAAGACCGCTATCTTTCGATGTC
GACATCGAAAGATAGCGGTCTTTGCTGTAAGATACCCGAAAATCGTGTATTTGCTCATAGACACTGTAAAAAAGTGGTAATTAGCTGCTAGACACTCCTC[T/C]
TATTATTTTATTATTTCCGGTCGAAACGGAGAGAGGGACTTTGGTTAAAGACAAGTTTGCCCATGGGCCCACTTATCAATCCCTCTTTCTCTATTCTTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.80% | 23.70% | 0.06% | 0.44% | NA |
| All Indica | 2759 | 98.40% | 1.40% | 0.04% | 0.14% | NA |
| All Japonica | 1512 | 30.70% | 68.50% | 0.00% | 0.79% | NA |
| Aus | 269 | 94.80% | 3.30% | 0.00% | 1.86% | NA |
| Indica I | 595 | 98.00% | 1.30% | 0.00% | 0.67% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.80% | 53.00% | 0.00% | 2.18% | NA |
| Japonica Intermediate | 241 | 47.70% | 51.90% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004260807 | A -> G | LOC_Os10g07974.1 | upstream_gene_variant ; 403.0bp to feature; MODIFIER | silent_mutation | Average:77.206; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg1004260807 | A -> G | LOC_Os10g07978.1 | upstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:77.206; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg1004260807 | A -> G | LOC_Os10g07978.2 | upstream_gene_variant ; 1708.0bp to feature; MODIFIER | silent_mutation | Average:77.206; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg1004260807 | A -> G | LOC_Os10g07974-LOC_Os10g07978 | intergenic_region ; MODIFIER | silent_mutation | Average:77.206; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| vg1004260807 | A -> DEL | N | N | silent_mutation | Average:77.206; most accessible tissue: Minghui63 panicle, score: 87.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004260807 | 2.53E-09 | 9.67E-21 | mr1768 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004260807 | NA | 7.42E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004260807 | 5.40E-07 | 1.26E-27 | mr1768_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |