Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004245904:

Variant ID: vg1004245904 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4245904
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATCATCTATAGTCAATTTAATATCCAATTTATACAATAGTTATCTATAAACATGTACTGCATAATTAACGTCTAATACCACCTGTCATACACACATGCA[T/C]
CTTGTAGTCTGTGCTACAGCTGGCTATAAATATGTAGCCTGATGTTTTTATTTATCCTCTTTTATCTACTTAAAATATTTCCAACCGGCACCTATTGGTC

Reverse complement sequence

GACCAATAGGTGCCGGTTGGAAATATTTTAAGTAGATAAAAGAGGATAAATAAAAACATCAGGCTACATATTTATAGCCAGCTGTAGCACAGACTACAAG[A/G]
TGCATGTGTGTATGACAGGTGGTATTAGACGTTAATTATGCAGTACATGTTTATAGATAACTATTGTATAAATTGGATATTAAATTGACTATAGATGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	16.80%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.80%	0.07%	0.00%	NA
All Japonica	1512	51.40%	48.60%	0.00%	0.00%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	21.30%	78.70%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	56.80%	43.20%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004245904	T -> C	LOC_Os10g07966.1	downstream_gene_variant ; 297.0bp to feature; MODIFIER	silent_mutation	Average:47.182; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N
vg1004245904	T -> C	LOC_Os10g07966-LOC_Os10g07970	intergenic_region ; MODIFIER	silent_mutation	Average:47.182; most accessible tissue: Minghui63 flag leaf, score: 61.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004245904	NA	5.29E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	4.11E-22	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	5.90E-36	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	6.65E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	7.14E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	8.65E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	2.52E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	2.35E-11	1.03E-24	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	9.27E-07	2.36E-08	mr1768	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	8.28E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	2.49E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	7.36E-14	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	5.88E-33	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	3.94E-39	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	8.98E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	8.04E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	2.89E-07	5.43E-29	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	4.16E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	7.60E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	3.88E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004245904	NA	1.83E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251