Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004244571:

Variant ID: vg1004244571 (JBrowse)	Variation Type: INDEL
Chromosome: chr10	Position: 4244571
Reference Allele: C	Alternative Allele: A,G,CTTCTAAATTTAG
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, A: 0.06, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAAAAAAAGGGGATATGACGTATTCTAATAACATGAATCTAGTTTATTTTGAGATAGAGGTTGTAGGTCAGTTCGGATCCGTTCACACACTTTGTCA[C/A,G,CTTCTAAATTTAG]
CACACTTATGGGAAGAAGTGATTTTTTTAATCCCTAGGATAAAAAATGATGGGCAAAATTTGCTACAGGACACTCAAAGATTGTGGTCTTTGCTGTGAGA

Reverse complement sequence

TCTCACAGCAAAGACCACAATCTTTGAGTGTCCTGTAGCAAATTTTGCCCATCATTTTTTATCCTAGGGATTAAAAAAATCACTTCTTCCCATAAGTGTG[G/T,C,CTAAATTTAGAAG]
TGACAAAGTGTGTGAACGGATCCGAACTGACCTACAACCTCTATCTCAAAATAAACTAGATTCATGTTATTAGAATACGTCATATCCCCTTTTTTTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.30%	23.40%	8.76%	18.81%	G: 0.40%; CTTCTAAATTTAG: 0.30%
All Indica	2759	69.20%	6.90%	8.12%	15.08%	G: 0.36%; CTTCTAAATTTAG: 0.33%
All Japonica	1512	21.40%	51.90%	4.76%	21.43%	G: 0.46%; CTTCTAAATTTAG: 0.07%
Aus	269	1.90%	26.40%	39.41%	30.48%	CTTCTAAATTTAG: 1.12%; G: 0.74%
Indica I	595	58.00%	7.90%	21.01%	12.61%	G: 0.34%; CTTCTAAATTTAG: 0.17%
Indica II	465	71.60%	6.50%	7.31%	13.76%	G: 0.43%; CTTCTAAATTTAG: 0.43%
Indica III	913	72.20%	6.70%	2.08%	18.51%	CTTCTAAATTTAG: 0.33%; G: 0.22%
Indica Intermediate	786	72.90%	6.60%	5.85%	13.74%	G: 0.51%; CTTCTAAATTTAG: 0.38%
Temperate Japonica	767	6.00%	79.50%	6.00%	8.34%	CTTCTAAATTTAG: 0.13%
Tropical Japonica	504	49.60%	11.10%	3.57%	34.52%	G: 1.19%
Japonica Intermediate	241	11.60%	49.00%	3.32%	35.68%	G: 0.41%
VI/Aromatic	96	3.10%	37.50%	4.17%	54.17%	CTTCTAAATTTAG: 1.04%
Intermediate	90	46.70%	27.80%	8.89%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004244571	C -> CTTCTAAATTTAG	LOC_Os10g07966.1	intron_variant ; MODIFIER	silent_mutation	Average:37.747; most accessible tissue: Callus, score: 64.294	N	N	N	N
vg1004244571	C -> G	LOC_Os10g07966.1	intron_variant ; MODIFIER	silent_mutation	Average:37.747; most accessible tissue: Callus, score: 64.294	N	N	N	N
vg1004244571	C -> A	LOC_Os10g07966.1	intron_variant ; MODIFIER	silent_mutation	Average:37.747; most accessible tissue: Callus, score: 64.294	N	N	N	N
vg1004244571	C -> DEL	N	N	silent_mutation	Average:37.747; most accessible tissue: Callus, score: 64.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004244571	NA	6.66E-07	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	5.78E-08	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	3.23E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	4.07E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	9.74E-06	mr1707_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	1.47E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	1.71E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	8.86E-08	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	5.39E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	3.89E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004244571	NA	1.88E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251