Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004230664:

Variant ID: vg1004230664 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4230664
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTTATATAAAGAAGTTTCTGGATCCATTTCAAGTCTGTTTGCCAAAAAAAGGCCTTTCCAACTTTCTTTGCGTCCAGACTCTCAGCTTCTGCAATCTCC[T/C]
GAAGAAAACCCTAACTTTCCTCTTCCTCTCCGGTGATCCTACGATGGTGATGGATCTTGGGGCTTCCAGCACCGACACCGCAGCCATGAAGAAGCTACAG

Reverse complement sequence

CTGTAGCTTCTTCATGGCTGCGGTGTCGGTGCTGGAAGCCCCAAGATCCATCACCATCGTAGGATCACCGGAGAGGAAGAGGAAAGTTAGGGTTTTCTTC[A/G]
GGAGATTGCAGAAGCTGAGAGTCTGGACGCAAAGAAAGTTGGAAAGGCCTTTTTTTGGCAAACAGACTTGAAATGGATCCAGAAACTTCTTTATATAAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	14.90%	0.57%	1.10%	NA
All Indica	2759	99.10%	0.90%	0.04%	0.00%	NA
All Japonica	1512	52.50%	42.40%	1.72%	3.37%	NA
Aus	269	96.70%	3.30%	0.00%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.20%	0.80%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.80%	0.00%	0.00%	NA
Temperate Japonica	767	23.10%	67.10%	3.13%	6.65%	NA
Tropical Japonica	504	94.80%	5.20%	0.00%	0.00%	NA
Japonica Intermediate	241	57.70%	41.50%	0.83%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004230664	T -> C	LOC_Os10g07618.1	upstream_gene_variant ; 44.0bp to feature; MODIFIER	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1004230664	T -> C	LOC_Os10g07616.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1004230664	T -> C	LOC_Os10g07622.1	downstream_gene_variant ; 1552.0bp to feature; MODIFIER	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1004230664	T -> C	LOC_Os10g07624.1	downstream_gene_variant ; 4846.0bp to feature; MODIFIER	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1004230664	T -> C	LOC_Os10g07616-LOC_Os10g07618	intergenic_region ; MODIFIER	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1004230664	T -> DEL	N	N	silent_mutation	Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004230664	NA	3.16E-06	Yield	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004230664	NA	6.75E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	8.40E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	2.41E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	2.57E-12	7.46E-26	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	9.16E-08	5.84E-09	mr1768	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	9.26E-07	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	6.83E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	3.11E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	4.12E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	3.42E-09	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	4.84E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	2.03E-11	2.15E-33	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	1.38E-06	5.36E-08	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664	NA	6.01E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251