\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004230664:

Variant ID: vg1004230664 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4230664
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTATATAAAGAAGTTTCTGGATCCATTTCAAGTCTGTTTGCCAAAAAAAGGCCTTTCCAACTTTCTTTGCGTCCAGACTCTCAGCTTCTGCAATCTCC[T/C]
GAAGAAAACCCTAACTTTCCTCTTCCTCTCCGGTGATCCTACGATGGTGATGGATCTTGGGGCTTCCAGCACCGACACCGCAGCCATGAAGAAGCTACAG

Reverse complement sequence

CTGTAGCTTCTTCATGGCTGCGGTGTCGGTGCTGGAAGCCCCAAGATCCATCACCATCGTAGGATCACCGGAGAGGAAGAGGAAAGTTAGGGTTTTCTTC[A/G]
GGAGATTGCAGAAGCTGAGAGTCTGGACGCAAAGAAAGTTGGAAAGGCCTTTTTTTGGCAAACAGACTTGAAATGGATCCAGAAACTTCTTTATATAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 14.90% 0.57% 1.10% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 52.50% 42.40% 1.72% 3.37% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 23.10% 67.10% 3.13% 6.65% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 57.70% 41.50% 0.83% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004230664 T -> C LOC_Os10g07618.1 upstream_gene_variant ; 44.0bp to feature; MODIFIER silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1004230664 T -> C LOC_Os10g07616.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1004230664 T -> C LOC_Os10g07622.1 downstream_gene_variant ; 1552.0bp to feature; MODIFIER silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1004230664 T -> C LOC_Os10g07624.1 downstream_gene_variant ; 4846.0bp to feature; MODIFIER silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1004230664 T -> C LOC_Os10g07616-LOC_Os10g07618 intergenic_region ; MODIFIER silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1004230664 T -> DEL N N silent_mutation Average:43.106; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004230664 NA 3.16E-06 Yield Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1004230664 NA 6.75E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 8.40E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 2.41E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 2.57E-12 7.46E-26 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 9.16E-08 5.84E-09 mr1768 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 9.26E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 6.83E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 3.11E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 4.12E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 3.42E-09 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 4.84E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 2.03E-11 2.15E-33 mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 1.38E-06 5.36E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004230664 NA 6.01E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251