\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004081061:

Variant ID: vg1004081061 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4081061
Reference Allele: TAlternative Allele: A,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.02, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


CCACCAGGAAGGCGTAGTCGCAGGGGCTGAAGTTGAGGTTTCTCTTATGGGAGCTGGAATAGAAACTCACCATGTTGTCCGTGATGTCCGGCGGGATGTT[T/A,G]
ACTTGGCAGCAGCCGACGCCGTCGCAGTTGCCGCTCACCGCGCTGCTGGAATCGTTGCAGTAGCACAGGCAGCCGGTGTACGAGACGTGGTCGTAGTCGT

Reverse complement sequence

ACGACTACGACCACGTCTCGTACACCGGCTGCCTGTGCTACTGCAACGATTCCAGCAGCGCGGTGAGCGGCAACTGCGACGGCGTCGGCTGCTGCCAAGT[A/T,C]
AACATCCCGCCGGACATCACGGACAACATGGTGAGTTTCTATTCCAGCTCCCATAAGAGAAACCTCAACTTCAGCCCCTGCGACTACGCCTTCCTGGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 40.80% 0.76% 0.95% G: 6.37%
All Indica  2759 54.30% 38.50% 0.43% 0.72% G: 6.09%
All Japonica  1512 40.70% 48.30% 1.46% 1.39% G: 8.13%
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 72.30% 27.40% 0.17% 0.00% G: 0.17%
Indica II  465 60.20% 27.30% 0.86% 1.29% G: 10.32%
Indica III  913 39.90% 48.80% 0.44% 1.10% G: 9.75%
Indica Intermediate  786 53.80% 41.50% 0.38% 0.51% G: 3.82%
Temperate Japonica  767 21.00% 72.90% 1.04% 0.52% G: 4.56%
Tropical Japonica  504 75.20% 13.10% 1.59% 1.98% G: 8.13%
Japonica Intermediate  241 31.50% 43.60% 2.49% 2.90% G: 19.50%
VI/Aromatic  96 3.10% 83.30% 1.04% 4.17% G: 8.33%
Intermediate  90 53.30% 43.30% 1.11% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004081061 T -> G LOC_Os10g07556.1 synonymous_variant ; p.Val187Val; LOW synonymous_codon Average:73.962; most accessible tissue: Zhenshan97 root, score: 88.474 N N N N
vg1004081061 T -> A LOC_Os10g07556.1 synonymous_variant ; p.Val187Val; LOW synonymous_codon Average:73.962; most accessible tissue: Zhenshan97 root, score: 88.474 N N N N
vg1004081061 T -> DEL LOC_Os10g07556.1 N frameshift_variant Average:73.962; most accessible tissue: Zhenshan97 root, score: 88.474 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1004081061 T A -0.02 0.0 -0.01 0.0 0.0 0.0
vg1004081061 T G 0.03 0.0 -0.01 0.01 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004081061 NA 3.44E-08 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004081061 NA 1.32E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004081061 NA 4.29E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004081061 4.42E-06 5.26E-09 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004081061 NA 6.21E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004081061 NA 4.55E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251