\
| Variant ID: vg1004077056 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4077056 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 103. )
TTCGTCCACCAATATAAGGGATTCTAGAGTACTACTTATCCCATCAATCACATTGATTTCATTAAAAAAATTCGTATTATCCCCGACTACACTCACACAT[T/C]
CAGCATCTCATTTAACCAAGGGCATCATTGTTTTTCTCTGCATACCCAAAGTCTGTAGTATTTGTTGATGGAGGGAATACACAAAAGACCACCCATTTGT
ACAAATGGGTGGTCTTTTGTGTATTCCCTCCATCAACAAATACTACAGACTTTGGGTATGCAGAGAAAAACAATGATGCCCTTGGTTAAATGAGATGCTG[A/G]
ATGTGTGAGTGTAGTCGGGGATAATACGAATTTTTTTAATGAAATCAATGTGATTGATGGGATAAGTAGTACTCTAGAATCCCTTATATTGGTGGACGAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.30% | 36.50% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 43.30% | 56.40% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 43.40% | 56.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 50.80% | 49.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 44.60% | 55.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 37.30% | 62.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 83.60% | 16.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004077056 | T -> C | LOC_Os10g07554.1 | downstream_gene_variant ; 3114.0bp to feature; MODIFIER | silent_mutation | Average:40.339; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| vg1004077056 | T -> C | LOC_Os10g07556.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.339; most accessible tissue: Callus, score: 70.731 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004077056 | NA | 9.80E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 6.50E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | 6.24E-06 | 1.52E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 2.20E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 5.59E-06 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 1.47E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 8.58E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 2.81E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 7.63E-07 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 1.18E-06 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 7.93E-11 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 3.37E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 2.98E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 2.59E-08 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 1.93E-09 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 2.18E-07 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 1.47E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 4.33E-06 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 3.34E-06 | mr1994_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004077056 | NA | 8.05E-08 | mr1994_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |