\
| Variant ID: vg1004031418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4031418 |
| Reference Allele: T | Alternative Allele: A,C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CTATAAAGTTGTTAAGACGTTTCTCAATCACAGCGAGGGTCACACTGCTCAACAGCACACAGAGTTTTGTCCTGATGGCAGTCTACGGTCCCACAAGTAA[T/A,C]
GGGCAGGCCGGAGCCATGGACATACAATCTCAACTGGTCTTCCATAGGGATCGCCCCGACAGAGATGCCTAGTCTGGATGACCCCTTCATAGAAGCAGAG
CTCTGCTTCTATGAAGGGGTCATCCAGACTAGGCATCTCTGTCGGGGCGATCCCTATGGAAGACCAGTTGAGATTGTATGTCCATGGCTCCGGCCTGCCC[A/T,G]
TTACTTGTGGGACCGTAGACTGCCATCAGGACAAAACTCTGTGTGCTGTTGAGCAGTGTGACCCTCGCTGTGATTGAGAAACGTCTTAACAACTTTATAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.70% | 7.40% | 4.25% | 7.07% | A: 0.57% |
| All Indica | 2759 | 77.70% | 8.00% | 3.99% | 9.53% | A: 0.76% |
| All Japonica | 1512 | 88.20% | 4.80% | 3.70% | 3.04% | A: 0.26% |
| Aus | 269 | 68.80% | 16.40% | 9.67% | 4.46% | A: 0.74% |
| Indica I | 595 | 88.10% | 4.50% | 5.04% | 1.51% | A: 0.84% |
| Indica II | 465 | 77.00% | 7.30% | 4.95% | 9.03% | A: 1.72% |
| Indica III | 913 | 67.40% | 10.70% | 2.96% | 18.51% | A: 0.44% |
| Indica Intermediate | 786 | 82.20% | 8.00% | 3.82% | 5.47% | A: 0.51% |
| Temperate Japonica | 767 | 94.30% | 2.00% | 1.96% | 1.83% | NA |
| Tropical Japonica | 504 | 86.10% | 6.50% | 4.17% | 2.78% | A: 0.40% |
| Japonica Intermediate | 241 | 73.40% | 10.00% | 8.30% | 7.47% | A: 0.83% |
| VI/Aromatic | 96 | 74.00% | 8.30% | 7.29% | 10.42% | NA |
| Intermediate | 90 | 91.10% | 3.30% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004031418 | T -> C | LOC_Os10g07536.1 | upstream_gene_variant ; 690.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> C | LOC_Os10g07534.1 | downstream_gene_variant ; 1723.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> C | LOC_Os10g07538.1 | downstream_gene_variant ; 3257.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> C | LOC_Os10g07534-LOC_Os10g07536 | intergenic_region ; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> A | LOC_Os10g07536.1 | upstream_gene_variant ; 690.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> A | LOC_Os10g07534.1 | downstream_gene_variant ; 1723.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> A | LOC_Os10g07538.1 | downstream_gene_variant ; 3257.0bp to feature; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> A | LOC_Os10g07534-LOC_Os10g07536 | intergenic_region ; MODIFIER | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| vg1004031418 | T -> DEL | N | N | silent_mutation | Average:69.561; most accessible tissue: Callus, score: 80.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004031418 | NA | 2.11E-07 | mr1076 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 3.82E-08 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | 2.63E-08 | 4.67E-10 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.80E-06 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.21E-06 | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.81E-06 | mr1168 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.70E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 6.79E-10 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 2.76E-09 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.82E-09 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 1.57E-06 | mr1437 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 5.92E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | NA | 3.90E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | 1.17E-07 | NA | mr1110_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004031418 | 4.41E-06 | NA | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |