\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004031418:

Variant ID: vg1004031418 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4031418
Reference Allele: TAlternative Allele: A,C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATAAAGTTGTTAAGACGTTTCTCAATCACAGCGAGGGTCACACTGCTCAACAGCACACAGAGTTTTGTCCTGATGGCAGTCTACGGTCCCACAAGTAA[T/A,C]
GGGCAGGCCGGAGCCATGGACATACAATCTCAACTGGTCTTCCATAGGGATCGCCCCGACAGAGATGCCTAGTCTGGATGACCCCTTCATAGAAGCAGAG

Reverse complement sequence

CTCTGCTTCTATGAAGGGGTCATCCAGACTAGGCATCTCTGTCGGGGCGATCCCTATGGAAGACCAGTTGAGATTGTATGTCCATGGCTCCGGCCTGCCC[A/T,G]
TTACTTGTGGGACCGTAGACTGCCATCAGGACAAAACTCTGTGTGCTGTTGAGCAGTGTGACCCTCGCTGTGATTGAGAAACGTCTTAACAACTTTATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.70% 7.40% 4.25% 7.07% A: 0.57%
All Indica  2759 77.70% 8.00% 3.99% 9.53% A: 0.76%
All Japonica  1512 88.20% 4.80% 3.70% 3.04% A: 0.26%
Aus  269 68.80% 16.40% 9.67% 4.46% A: 0.74%
Indica I  595 88.10% 4.50% 5.04% 1.51% A: 0.84%
Indica II  465 77.00% 7.30% 4.95% 9.03% A: 1.72%
Indica III  913 67.40% 10.70% 2.96% 18.51% A: 0.44%
Indica Intermediate  786 82.20% 8.00% 3.82% 5.47% A: 0.51%
Temperate Japonica  767 94.30% 2.00% 1.96% 1.83% NA
Tropical Japonica  504 86.10% 6.50% 4.17% 2.78% A: 0.40%
Japonica Intermediate  241 73.40% 10.00% 8.30% 7.47% A: 0.83%
VI/Aromatic  96 74.00% 8.30% 7.29% 10.42% NA
Intermediate  90 91.10% 3.30% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004031418 T -> C LOC_Os10g07536.1 upstream_gene_variant ; 690.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> C LOC_Os10g07534.1 downstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> C LOC_Os10g07538.1 downstream_gene_variant ; 3257.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> C LOC_Os10g07534-LOC_Os10g07536 intergenic_region ; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> A LOC_Os10g07536.1 upstream_gene_variant ; 690.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> A LOC_Os10g07534.1 downstream_gene_variant ; 1723.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> A LOC_Os10g07538.1 downstream_gene_variant ; 3257.0bp to feature; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> A LOC_Os10g07534-LOC_Os10g07536 intergenic_region ; MODIFIER silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N
vg1004031418 T -> DEL N N silent_mutation Average:69.561; most accessible tissue: Callus, score: 80.028 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004031418 NA 2.11E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 3.82E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 2.63E-08 4.67E-10 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.80E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.21E-06 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.81E-06 mr1168 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.70E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 6.79E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 2.76E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.82E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 1.57E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 5.92E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 NA 3.90E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 1.17E-07 NA mr1110_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004031418 4.41E-06 NA mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251