\
| Variant ID: vg1004023838 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4023838 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 286. )
AGTCCTCCACTTTATACCCAATCTCACTTTTCTTGTTCAATCCGAGATTCTTCAACCCTAGTAATTTCTGAGTTGTTTCAGGCAAAATAAAAAAATATTC[T/G]
TTGTTAGTTTTATCTATTAACTCCTATTGACTTGCTTGGGCGTTTATTGGGGTCTGGTGATACATCTTTACTTAGTAAGTTAGCCTTTTCATTTATTGTT
AACAATAAATGAAAAGGCTAACTTACTAAGTAAAGATGTATCACCAGACCCCAATAAACGCCCAAGCAAGTCAATAGGAGTTAATAGATAAAACTAACAA[A/C]
GAATATTTTTTTATTTTGCCTGAAACAACTCAGAAATTACTAGGGTTGAAGAATCTCGGATTGAACAAGAAAAGTGAGATTGGGTATAAAGTGGAGGACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 84.50% | 15.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.90% | 13.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 69.30% | 30.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004023838 | T -> G | LOC_Os10g07534.1 | upstream_gene_variant ; 3104.0bp to feature; MODIFIER | silent_mutation | Average:78.383; most accessible tissue: Zhenshan97 root, score: 89.533 | N | N | N | N |
| vg1004023838 | T -> G | LOC_Os10g07530-LOC_Os10g07534 | intergenic_region ; MODIFIER | silent_mutation | Average:78.383; most accessible tissue: Zhenshan97 root, score: 89.533 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004023838 | NA | 9.42E-14 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1004023838 | NA | 8.25E-07 | mr1042 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 6.41E-06 | mr1043 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 3.43E-06 | mr1269 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 3.60E-07 | mr1489 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 1.25E-10 | mr1495 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 7.00E-08 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 8.21E-06 | mr1820 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 9.70E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 5.38E-06 | mr1922 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | 7.82E-06 | NA | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 1.51E-08 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 1.89E-07 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 9.42E-07 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 4.68E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 3.37E-08 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 7.93E-09 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004023838 | NA | 3.96E-06 | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |