Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004020304:

Variant ID: vg1004020304 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 4020304
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, T: 0.35, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATCGGCGGTAGATATTGGTAGGATGCGCTTAAGGCCGAAATTTTCAATTTTTTAATCAAAAAATCTTTCAAAATCAGTGAAAGTTCATTTGGGCTTT[T/A]
TTTTTTTTAAAAAAAAGTCAGAATTACCCCCTAACTACCACGATCATCTGAATCACCGCCGTGAATTAAAAAGTAGATATTTTGTATCCTCGACTATTCA

Reverse complement sequence

TGAATAGTCGAGGATACAAAATATCTACTTTTTAATTCACGGCGGTGATTCAGATGATCGTGGTAGTTAGGGGGTAATTCTGACTTTTTTTTAAAAAAAA[A/T]
AAAGCCCAAATGAACTTTCACTGATTTTGAAAGATTTTTTGATTAAAAAATTGAAAATTTCGGCCTTAAGCGCATCCTACCAATATCTACCGCCGATAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.60%	17.20%	3.81%	60.35%	NA
All Indica	2759	7.70%	3.80%	2.72%	85.76%	NA
All Japonica	1512	40.30%	43.80%	3.31%	12.63%	NA
Aus	269	4.50%	4.80%	0.37%	90.33%	NA
Indica I	595	2.50%	0.80%	0.50%	96.13%	NA
Indica II	465	1.50%	1.70%	0.65%	96.13%	NA
Indica III	913	16.20%	6.10%	4.71%	72.95%	NA
Indica Intermediate	786	5.50%	4.60%	3.31%	86.64%	NA
Temperate Japonica	767	23.20%	69.50%	0.65%	6.65%	NA
Tropical Japonica	504	71.20%	8.50%	6.55%	13.69%	NA
Japonica Intermediate	241	29.90%	35.70%	4.98%	29.46%	NA
VI/Aromatic	96	21.90%	16.70%	46.88%	14.58%	NA
Intermediate	90	27.80%	20.00%	10.00%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1004020304	T -> A	LOC_Os10g07530.1	upstream_gene_variant ; 4225.0bp to feature; MODIFIER	silent_mutation	Average:38.864; most accessible tissue: Callus, score: 63.045	N	N	N	N
vg1004020304	T -> A	LOC_Os10g07530-LOC_Os10g07534	intergenic_region ; MODIFIER	silent_mutation	Average:38.864; most accessible tissue: Callus, score: 63.045	N	N	N	N
vg1004020304	T -> DEL	N	N	silent_mutation	Average:38.864; most accessible tissue: Callus, score: 63.045	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1004020304	NA	2.05E-14	mr1379_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	1.19E-08	mr1379_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	1.28E-10	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	4.61E-09	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	9.56E-06	mr1562_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	3.27E-09	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	4.75E-11	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	1.31E-06	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304	NA	4.96E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251