\
| Variant ID: vg1004020304 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 4020304 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, T: 0.35, others allele: 0.00, population size: 84. )
TTTATCGGCGGTAGATATTGGTAGGATGCGCTTAAGGCCGAAATTTTCAATTTTTTAATCAAAAAATCTTTCAAAATCAGTGAAAGTTCATTTGGGCTTT[T/A]
TTTTTTTTAAAAAAAAGTCAGAATTACCCCCTAACTACCACGATCATCTGAATCACCGCCGTGAATTAAAAAGTAGATATTTTGTATCCTCGACTATTCA
TGAATAGTCGAGGATACAAAATATCTACTTTTTAATTCACGGCGGTGATTCAGATGATCGTGGTAGTTAGGGGGTAATTCTGACTTTTTTTTAAAAAAAA[A/T]
AAAGCCCAAATGAACTTTCACTGATTTTGAAAGATTTTTTGATTAAAAAATTGAAAATTTCGGCCTTAAGCGCATCCTACCAATATCTACCGCCGATAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 18.60% | 17.20% | 3.81% | 60.35% | NA |
| All Indica | 2759 | 7.70% | 3.80% | 2.72% | 85.76% | NA |
| All Japonica | 1512 | 40.30% | 43.80% | 3.31% | 12.63% | NA |
| Aus | 269 | 4.50% | 4.80% | 0.37% | 90.33% | NA |
| Indica I | 595 | 2.50% | 0.80% | 0.50% | 96.13% | NA |
| Indica II | 465 | 1.50% | 1.70% | 0.65% | 96.13% | NA |
| Indica III | 913 | 16.20% | 6.10% | 4.71% | 72.95% | NA |
| Indica Intermediate | 786 | 5.50% | 4.60% | 3.31% | 86.64% | NA |
| Temperate Japonica | 767 | 23.20% | 69.50% | 0.65% | 6.65% | NA |
| Tropical Japonica | 504 | 71.20% | 8.50% | 6.55% | 13.69% | NA |
| Japonica Intermediate | 241 | 29.90% | 35.70% | 4.98% | 29.46% | NA |
| VI/Aromatic | 96 | 21.90% | 16.70% | 46.88% | 14.58% | NA |
| Intermediate | 90 | 27.80% | 20.00% | 10.00% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1004020304 | T -> A | LOC_Os10g07530.1 | upstream_gene_variant ; 4225.0bp to feature; MODIFIER | silent_mutation | Average:38.864; most accessible tissue: Callus, score: 63.045 | N | N | N | N |
| vg1004020304 | T -> A | LOC_Os10g07530-LOC_Os10g07534 | intergenic_region ; MODIFIER | silent_mutation | Average:38.864; most accessible tissue: Callus, score: 63.045 | N | N | N | N |
| vg1004020304 | T -> DEL | N | N | silent_mutation | Average:38.864; most accessible tissue: Callus, score: 63.045 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1004020304 | NA | 2.05E-14 | mr1379_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 1.19E-08 | mr1379_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 1.28E-10 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 4.61E-09 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 9.56E-06 | mr1562_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 3.27E-09 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 4.75E-11 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 1.31E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1004020304 | NA | 4.96E-09 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |