\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1004020304:

Variant ID: vg1004020304 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 4020304
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, T: 0.35, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATCGGCGGTAGATATTGGTAGGATGCGCTTAAGGCCGAAATTTTCAATTTTTTAATCAAAAAATCTTTCAAAATCAGTGAAAGTTCATTTGGGCTTT[T/A]
TTTTTTTTAAAAAAAAGTCAGAATTACCCCCTAACTACCACGATCATCTGAATCACCGCCGTGAATTAAAAAGTAGATATTTTGTATCCTCGACTATTCA

Reverse complement sequence

TGAATAGTCGAGGATACAAAATATCTACTTTTTAATTCACGGCGGTGATTCAGATGATCGTGGTAGTTAGGGGGTAATTCTGACTTTTTTTTAAAAAAAA[A/T]
AAAGCCCAAATGAACTTTCACTGATTTTGAAAGATTTTTTGATTAAAAAATTGAAAATTTCGGCCTTAAGCGCATCCTACCAATATCTACCGCCGATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.60% 17.20% 3.81% 60.35% NA
All Indica  2759 7.70% 3.80% 2.72% 85.76% NA
All Japonica  1512 40.30% 43.80% 3.31% 12.63% NA
Aus  269 4.50% 4.80% 0.37% 90.33% NA
Indica I  595 2.50% 0.80% 0.50% 96.13% NA
Indica II  465 1.50% 1.70% 0.65% 96.13% NA
Indica III  913 16.20% 6.10% 4.71% 72.95% NA
Indica Intermediate  786 5.50% 4.60% 3.31% 86.64% NA
Temperate Japonica  767 23.20% 69.50% 0.65% 6.65% NA
Tropical Japonica  504 71.20% 8.50% 6.55% 13.69% NA
Japonica Intermediate  241 29.90% 35.70% 4.98% 29.46% NA
VI/Aromatic  96 21.90% 16.70% 46.88% 14.58% NA
Intermediate  90 27.80% 20.00% 10.00% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1004020304 T -> A LOC_Os10g07530.1 upstream_gene_variant ; 4225.0bp to feature; MODIFIER silent_mutation Average:38.864; most accessible tissue: Callus, score: 63.045 N N N N
vg1004020304 T -> A LOC_Os10g07530-LOC_Os10g07534 intergenic_region ; MODIFIER silent_mutation Average:38.864; most accessible tissue: Callus, score: 63.045 N N N N
vg1004020304 T -> DEL N N silent_mutation Average:38.864; most accessible tissue: Callus, score: 63.045 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1004020304 NA 2.05E-14 mr1379_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 1.19E-08 mr1379_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 1.28E-10 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 4.61E-09 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 9.56E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 3.27E-09 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 4.75E-11 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 1.31E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1004020304 NA 4.96E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251