\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003956758:

Variant ID: vg1003956758 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3956758
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ACTGCCACGTAGGCGCCACGTCAGCTAAAACCACCTCCAAAACCACTTAGGGACATTGTTTGCACCGGTTTTGTGGTTGGAGGACATGAATCATACTCGG[G/A]
CGATAGTTGAGGGAGTCCAAGTATACTTTTTCCTTAGATAAAATCATAAAAGGTGGTCTTTAGGACTTGGCAAACTCTTCTTGGAAAAAGTAGACCGAAG

Reverse complement sequence

CTTCGGTCTACTTTTTCCAAGAAGAGTTTGCCAAGTCCTAAAGACCACCTTTTATGATTTTATCTAAGGAAAAAGTATACTTGGACTCCCTCAACTATCG[C/T]
CCGAGTATGATTCATGTCCTCCAACCACAAAACCGGTGCAAACAATGTCCCTAAGTGGTTTTGGAGGTGGTTTTAGCTGACGTGGCGCCTACGTGGCAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.40% 0.21% 0.00% NA
All Indica  2759 55.60% 44.00% 0.36% 0.00% NA
All Japonica  1512 65.40% 34.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 64.00% 35.50% 0.50% 0.00% NA
Indica II  465 64.10% 35.10% 0.86% 0.00% NA
Indica III  913 39.10% 60.60% 0.33% 0.00% NA
Indica Intermediate  786 63.40% 36.60% 0.00% 0.00% NA
Temperate Japonica  767 93.70% 6.30% 0.00% 0.00% NA
Tropical Japonica  504 22.40% 77.60% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003956758 G -> A LOC_Os10g07460.1 intron_variant ; MODIFIER silent_mutation Average:72.897; most accessible tissue: Minghui63 young leaf, score: 85.437 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003956758 G A -0.02 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003956758 NA 7.39E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 5.21E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 2.41E-08 mr1555 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 1.67E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 5.96E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 1.21E-11 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 1.43E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003956758 NA 1.12E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251