\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003944398:

Variant ID: vg1003944398 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3944398
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGGATTGGCATAGCGTTTCTATGGAAAATTTTTCTTTGAATCCTACAAACCGAATGCATGGATAGTGCTTATTGCATAGGAATTGAGATTTCCTTTAG[G/A]
AATCCTTCGAAACGAATAAGGCCTAATCATCTGCCCTGCCTTGCTTCCTTGGCTCGGTGCCACTTTCCGCCGGCCAACCACCGTACGTGCGCCCGTGCCG

Reverse complement sequence

CGGCACGGGCGCACGTACGGTGGTTGGCCGGCGGAAAGTGGCACCGAGCCAAGGAAGCAAGGCAGGGCAGATGATTAGGCCTTATTCGTTTCGAAGGATT[C/T]
CTAAAGGAAATCTCAATTCCTATGCAATAAGCACTATCCATGCATTCGGTTTGTAGGATTCAAAGAAAAATTTTCCATAGAAACGCTATGCCAATCCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.90% 41.00% 0.15% 1.99% NA
All Indica  2759 52.60% 43.80% 0.22% 3.37% NA
All Japonica  1512 64.70% 35.30% 0.00% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 40.30% 59.50% 0.17% 0.00% NA
Indica II  465 37.00% 62.40% 0.00% 0.65% NA
Indica III  913 74.60% 17.50% 0.11% 7.78% NA
Indica Intermediate  786 45.70% 51.40% 0.51% 2.42% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 21.80% 78.20% 0.00% 0.00% NA
Japonica Intermediate  241 63.10% 36.90% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003944398 G -> A LOC_Os10g07440.1 upstream_gene_variant ; 2357.0bp to feature; MODIFIER silent_mutation Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg1003944398 G -> A LOC_Os10g07450.2 downstream_gene_variant ; 4948.0bp to feature; MODIFIER silent_mutation Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg1003944398 G -> A LOC_Os10g07440-LOC_Os10g07450 intergenic_region ; MODIFIER silent_mutation Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N
vg1003944398 G -> DEL N N silent_mutation Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003944398 NA 3.24E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 8.04E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 9.90E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 2.07E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 2.12E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 2.38E-06 mr1239_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 5.60E-12 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 2.26E-08 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398 NA 3.39E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251