| Variant ID: vg1003944398 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3944398 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 105. )
GGAGGATTGGCATAGCGTTTCTATGGAAAATTTTTCTTTGAATCCTACAAACCGAATGCATGGATAGTGCTTATTGCATAGGAATTGAGATTTCCTTTAG[G/A]
AATCCTTCGAAACGAATAAGGCCTAATCATCTGCCCTGCCTTGCTTCCTTGGCTCGGTGCCACTTTCCGCCGGCCAACCACCGTACGTGCGCCCGTGCCG
CGGCACGGGCGCACGTACGGTGGTTGGCCGGCGGAAAGTGGCACCGAGCCAAGGAAGCAAGGCAGGGCAGATGATTAGGCCTTATTCGTTTCGAAGGATT[C/T]
CTAAAGGAAATCTCAATTCCTATGCAATAAGCACTATCCATGCATTCGGTTTGTAGGATTCAAAGAAAAATTTTCCATAGAAACGCTATGCCAATCCTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 41.00% | 0.15% | 1.99% | NA |
| All Indica | 2759 | 52.60% | 43.80% | 0.22% | 3.37% | NA |
| All Japonica | 1512 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 57.20% | 42.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.30% | 59.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 37.00% | 62.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 74.60% | 17.50% | 0.11% | 7.78% | NA |
| Indica Intermediate | 786 | 45.70% | 51.40% | 0.51% | 2.42% | NA |
| Temperate Japonica | 767 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.80% | 78.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 36.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003944398 | G -> A | LOC_Os10g07440.1 | upstream_gene_variant ; 2357.0bp to feature; MODIFIER | silent_mutation | Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg1003944398 | G -> A | LOC_Os10g07450.2 | downstream_gene_variant ; 4948.0bp to feature; MODIFIER | silent_mutation | Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg1003944398 | G -> A | LOC_Os10g07440-LOC_Os10g07450 | intergenic_region ; MODIFIER | silent_mutation | Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| vg1003944398 | G -> DEL | N | N | silent_mutation | Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003944398 | NA | 3.24E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 8.04E-07 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 9.90E-08 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 2.07E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 2.12E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 2.38E-06 | mr1239_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 5.60E-12 | mr1495_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 2.26E-08 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003944398 | NA | 3.39E-08 | mr1936_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |