Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003944398:

Variant ID: vg1003944398 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3944398
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGGATTGGCATAGCGTTTCTATGGAAAATTTTTCTTTGAATCCTACAAACCGAATGCATGGATAGTGCTTATTGCATAGGAATTGAGATTTCCTTTAG[G/A]
AATCCTTCGAAACGAATAAGGCCTAATCATCTGCCCTGCCTTGCTTCCTTGGCTCGGTGCCACTTTCCGCCGGCCAACCACCGTACGTGCGCCCGTGCCG

Reverse complement sequence

CGGCACGGGCGCACGTACGGTGGTTGGCCGGCGGAAAGTGGCACCGAGCCAAGGAAGCAAGGCAGGGCAGATGATTAGGCCTTATTCGTTTCGAAGGATT[C/T]
CTAAAGGAAATCTCAATTCCTATGCAATAAGCACTATCCATGCATTCGGTTTGTAGGATTCAAAGAAAAATTTTCCATAGAAACGCTATGCCAATCCTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	41.00%	0.15%	1.99%	NA
All Indica	2759	52.60%	43.80%	0.22%	3.37%	NA
All Japonica	1512	64.70%	35.30%	0.00%	0.00%	NA
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	40.30%	59.50%	0.17%	0.00%	NA
Indica II	465	37.00%	62.40%	0.00%	0.65%	NA
Indica III	913	74.60%	17.50%	0.11%	7.78%	NA
Indica Intermediate	786	45.70%	51.40%	0.51%	2.42%	NA
Temperate Japonica	767	93.50%	6.50%	0.00%	0.00%	NA
Tropical Japonica	504	21.80%	78.20%	0.00%	0.00%	NA
Japonica Intermediate	241	63.10%	36.90%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	60.00%	37.80%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003944398	G -> A	LOC_Os10g07440.1	upstream_gene_variant ; 2357.0bp to feature; MODIFIER	silent_mutation	Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg1003944398	G -> A	LOC_Os10g07450.2	downstream_gene_variant ; 4948.0bp to feature; MODIFIER	silent_mutation	Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg1003944398	G -> A	LOC_Os10g07440-LOC_Os10g07450	intergenic_region ; MODIFIER	silent_mutation	Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N
vg1003944398	G -> DEL	N	N	silent_mutation	Average:64.951; most accessible tissue: Zhenshan97 flag leaf, score: 81.212	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003944398	NA	3.24E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	8.04E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	9.90E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	2.07E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	2.12E-07	mr1123_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	2.38E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	5.60E-12	mr1495_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	2.26E-08	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003944398	NA	3.39E-08	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251