\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003830395:

Variant ID: vg1003830395 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3830395
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAGACCTTGAGGAACCGTTGAAAAACAATATTATCTTTTAGAATGACAATCATGGAAAGATCCAATGATATATATTTTAAACGGTGGATTGTACTTAC[G/C]
ATATCAATAACATATTTTACTATTTCCATGGGAGAATGAAAATGACTGCAAAAACTCTAGAAAGGAATGAAACTATCCCATTCTCACAGCTAATGGTGTT

Reverse complement sequence

AACACCATTAGCTGTGAGAATGGGATAGTTTCATTCCTTTCTAGAGTTTTTGCAGTCATTTTCATTCTCCCATGGAAATAGTAAAATATGTTATTGATAT[C/G]
GTAAGTACAATCCACCGTTTAAAATATATATCATTGGATCTTTCCATGATTGTCATTCTAAAAGATAATATTGTTTTTCAACGGTTCCTCAAGGTCTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.50% 0.08% 0.00% NA
All Indica  2759 77.20% 22.70% 0.07% 0.00% NA
All Japonica  1512 67.50% 32.30% 0.13% 0.00% NA
Aus  269 11.50% 88.50% 0.00% 0.00% NA
Indica I  595 68.60% 31.30% 0.17% 0.00% NA
Indica II  465 73.30% 26.50% 0.22% 0.00% NA
Indica III  913 81.70% 18.30% 0.00% 0.00% NA
Indica Intermediate  786 80.90% 19.10% 0.00% 0.00% NA
Temperate Japonica  767 93.60% 6.40% 0.00% 0.00% NA
Tropical Japonica  504 26.60% 73.20% 0.20% 0.00% NA
Japonica Intermediate  241 70.10% 29.50% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 57.80% 42.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003830395 G -> C LOC_Os10g07270.1 downstream_gene_variant ; 1109.0bp to feature; MODIFIER silent_mutation Average:74.044; most accessible tissue: Zhenshan97 root, score: 97.783 N N N N
vg1003830395 G -> C LOC_Os10g07248-LOC_Os10g07270 intergenic_region ; MODIFIER silent_mutation Average:74.044; most accessible tissue: Zhenshan97 root, score: 97.783 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003830395 G C 0.08 0.01 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003830395 NA 2.30E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 2.40E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 7.29E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 1.07E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 4.12E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 4.55E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 4.25E-06 mr1219_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 8.71E-10 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 3.44E-09 mr1733_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003830395 NA 4.20E-08 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251