\
| Variant ID: vg1003769168 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3769168 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 99. )
AGGGATGCCGACGGGGGGCAAGGCATGCCAAGAATTTTGAGAAAATAATCATACGCAGCCTGAAGCTTGTCCTCTTCAGTTGTTGCAATGATGCTGTCCT[A/G]
ACAAATAGAGGAAATTGTCTTCTTCCTTCGACGAGCATTGATTTTGAGGCAGAAGAATTGAGCCGTGGTGCCTCTATGTTTCAGGAAAAGCAAGCGGGCA
TGCCCGCTTGCTTTTCCTGAAACATAGAGGCACCACGGCTCAATTCTTCTGCCTCAAAATCAATGCTCGTCGAAGGAAGAAGACAATTTCCTCTATTTGT[T/C]
AGGACAGCATCATTGCAACAACTGAAGAGGACAAGCTTCAGGCTGCGTATGATTATTTTCTCAAAATTCTTGGCATGCCTTGCCCCCCGTCGGCATCCCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 22.30% | 0.21% | 17.71% | NA |
| All Indica | 2759 | 60.80% | 8.80% | 0.33% | 30.05% | NA |
| All Japonica | 1512 | 47.80% | 52.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 66.60% | 16.50% | 0.84% | 16.13% | NA |
| Indica II | 465 | 65.20% | 9.50% | 0.22% | 25.16% | NA |
| Indica III | 913 | 49.40% | 2.00% | 0.00% | 48.63% | NA |
| Indica Intermediate | 786 | 67.20% | 10.60% | 0.38% | 21.88% | NA |
| Temperate Japonica | 767 | 12.50% | 87.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.40% | 38.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 17.80% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003769168 | A -> G | LOC_Os10g07180.1 | downstream_gene_variant ; 197.0bp to feature; MODIFIER | silent_mutation | Average:8.971; most accessible tissue: Callus, score: 29.871 | N | N | N | N |
| vg1003769168 | A -> G | LOC_Os10g07190.1 | downstream_gene_variant ; 4952.0bp to feature; MODIFIER | silent_mutation | Average:8.971; most accessible tissue: Callus, score: 29.871 | N | N | N | N |
| vg1003769168 | A -> G | LOC_Os10g07160-LOC_Os10g07180 | intergenic_region ; MODIFIER | silent_mutation | Average:8.971; most accessible tissue: Callus, score: 29.871 | N | N | N | N |
| vg1003769168 | A -> DEL | N | N | silent_mutation | Average:8.971; most accessible tissue: Callus, score: 29.871 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003769168 | NA | 2.33E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 1.55E-06 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 4.46E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 2.77E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | 1.87E-07 | 1.48E-06 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 6.68E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 3.34E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 5.92E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 9.34E-06 | mr1892 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003769168 | NA | 2.34E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |