Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003769168:

Variant ID: vg1003769168 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3769168
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

AGGGATGCCGACGGGGGGCAAGGCATGCCAAGAATTTTGAGAAAATAATCATACGCAGCCTGAAGCTTGTCCTCTTCAGTTGTTGCAATGATGCTGTCCT[A/G]
ACAAATAGAGGAAATTGTCTTCTTCCTTCGACGAGCATTGATTTTGAGGCAGAAGAATTGAGCCGTGGTGCCTCTATGTTTCAGGAAAAGCAAGCGGGCA

Reverse complement sequence

TGCCCGCTTGCTTTTCCTGAAACATAGAGGCACCACGGCTCAATTCTTCTGCCTCAAAATCAATGCTCGTCGAAGGAAGAAGACAATTTCCTCTATTTGT[T/C]
AGGACAGCATCATTGCAACAACTGAAGAGGACAAGCTTCAGGCTGCGTATGATTATTTTCTCAAAATTCTTGGCATGCCTTGCCCCCCGTCGGCATCCCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	22.30%	0.21%	17.71%	NA
All Indica	2759	60.80%	8.80%	0.33%	30.05%	NA
All Japonica	1512	47.80%	52.10%	0.00%	0.07%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	66.60%	16.50%	0.84%	16.13%	NA
Indica II	465	65.20%	9.50%	0.22%	25.16%	NA
Indica III	913	49.40%	2.00%	0.00%	48.63%	NA
Indica Intermediate	786	67.20%	10.60%	0.38%	21.88%	NA
Temperate Japonica	767	12.50%	87.40%	0.00%	0.13%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	61.40%	38.60%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	17.80%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003769168	A -> G	LOC_Os10g07180.1	downstream_gene_variant ; 197.0bp to feature; MODIFIER	silent_mutation	Average:8.971; most accessible tissue: Callus, score: 29.871	N	N	N	N
vg1003769168	A -> G	LOC_Os10g07190.1	downstream_gene_variant ; 4952.0bp to feature; MODIFIER	silent_mutation	Average:8.971; most accessible tissue: Callus, score: 29.871	N	N	N	N
vg1003769168	A -> G	LOC_Os10g07160-LOC_Os10g07180	intergenic_region ; MODIFIER	silent_mutation	Average:8.971; most accessible tissue: Callus, score: 29.871	N	N	N	N
vg1003769168	A -> DEL	N	N	silent_mutation	Average:8.971; most accessible tissue: Callus, score: 29.871	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003769168	NA	2.33E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	1.55E-06	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	4.46E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	2.77E-09	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	1.87E-07	1.48E-06	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	6.68E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	3.34E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	5.92E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	9.34E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168	NA	2.34E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251