\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003769168:

Variant ID: vg1003769168 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3769168
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, G: 0.47, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGGGATGCCGACGGGGGGCAAGGCATGCCAAGAATTTTGAGAAAATAATCATACGCAGCCTGAAGCTTGTCCTCTTCAGTTGTTGCAATGATGCTGTCCT[A/G]
ACAAATAGAGGAAATTGTCTTCTTCCTTCGACGAGCATTGATTTTGAGGCAGAAGAATTGAGCCGTGGTGCCTCTATGTTTCAGGAAAAGCAAGCGGGCA

Reverse complement sequence

TGCCCGCTTGCTTTTCCTGAAACATAGAGGCACCACGGCTCAATTCTTCTGCCTCAAAATCAATGCTCGTCGAAGGAAGAAGACAATTTCCTCTATTTGT[T/C]
AGGACAGCATCATTGCAACAACTGAAGAGGACAAGCTTCAGGCTGCGTATGATTATTTTCTCAAAATTCTTGGCATGCCTTGCCCCCCGTCGGCATCCCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 22.30% 0.21% 17.71% NA
All Indica  2759 60.80% 8.80% 0.33% 30.05% NA
All Japonica  1512 47.80% 52.10% 0.00% 0.07% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 66.60% 16.50% 0.84% 16.13% NA
Indica II  465 65.20% 9.50% 0.22% 25.16% NA
Indica III  913 49.40% 2.00% 0.00% 48.63% NA
Indica Intermediate  786 67.20% 10.60% 0.38% 21.88% NA
Temperate Japonica  767 12.50% 87.40% 0.00% 0.13% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 74.40% 17.80% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003769168 A -> G LOC_Os10g07180.1 downstream_gene_variant ; 197.0bp to feature; MODIFIER silent_mutation Average:8.971; most accessible tissue: Callus, score: 29.871 N N N N
vg1003769168 A -> G LOC_Os10g07190.1 downstream_gene_variant ; 4952.0bp to feature; MODIFIER silent_mutation Average:8.971; most accessible tissue: Callus, score: 29.871 N N N N
vg1003769168 A -> G LOC_Os10g07160-LOC_Os10g07180 intergenic_region ; MODIFIER silent_mutation Average:8.971; most accessible tissue: Callus, score: 29.871 N N N N
vg1003769168 A -> DEL N N silent_mutation Average:8.971; most accessible tissue: Callus, score: 29.871 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003769168 NA 2.33E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 1.55E-06 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 4.46E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 2.77E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 1.87E-07 1.48E-06 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 6.68E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 3.34E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 5.92E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 9.34E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003769168 NA 2.34E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251