RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1003749596:

Variant ID: vg1003749596 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3749596
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATTCACACACACCAAAGCATGAGCTGAATTACAAGAGGCTCTAGTGTACTTTATTGTATATTAGAATAGGGAGAGAGTACGGTAGAAGGAATCGGAGGA[A/G]
TCCTGGAGTTGTCGATAATCTCTTCTTATCTTTTGTATCTTGTTAATTACTCTGCTTTAATAGAAATATCATTTTGAGTAATTAAGATTTGCTTAGTGAG

Reverse complement sequence

CTCACTAAGCAAATCTTAATTACTCAAAATGATATTTCTATTAAAGCAGAGTAATTAACAAGATACAAAAGATAAGAAGAGATTATCGACAACTCCAGGA[T/C]
TCCTCCGATTCCTTCTACCGTACTCTCTCCCTATTCTAATATACAATAAAGTACACTAGAGCCTCTTGTAATTCAGCTCATGCTTTGGTGTGTGTGAATG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.20%	6.20%	2.54%	15.15%	NA
All Indica	2759	67.50%	3.30%	3.95%	25.26%	NA
All Japonica	1512	90.20%	9.80%	0.00%	0.00%	NA
Aus	269	97.00%	2.20%	0.37%	0.37%	NA
Indica I	595	84.00%	0.00%	1.85%	14.12%	NA
Indica II	465	75.30%	1.50%	3.44%	19.78%	NA
Indica III	913	44.40%	7.20%	6.02%	42.39%	NA
Indica Intermediate	786	77.40%	2.20%	3.44%	17.05%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	89.50%	10.50%	0.00%	0.00%	NA
Japonica Intermediate	241	76.30%	23.70%	0.00%	0.00%	NA
VI/Aromatic	96	38.50%	39.60%	9.38%	12.50%	NA
Intermediate	90	82.20%	10.00%	1.11%	6.67%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003749596	A -> G	LOC_Os10g07130.1	upstream_gene_variant ; 3447.0bp to feature; MODIFIER	silent_mutation	Average:10.643; most accessible tissue: Callus, score: 21.12	N	N	N	N
vg1003749596	A -> G	LOC_Os10g07150.2	downstream_gene_variant ; 582.0bp to feature; MODIFIER	silent_mutation	Average:10.643; most accessible tissue: Callus, score: 21.12	N	N	N	N
vg1003749596	A -> G	LOC_Os10g07150.1	downstream_gene_variant ; 582.0bp to feature; MODIFIER	silent_mutation	Average:10.643; most accessible tissue: Callus, score: 21.12	N	N	N	N
vg1003749596	A -> G	LOC_Os10g07130-LOC_Os10g07150	intergenic_region ; MODIFIER	silent_mutation	Average:10.643; most accessible tissue: Callus, score: 21.12	N	N	N	N
vg1003749596	A -> DEL	N	N	silent_mutation	Average:10.643; most accessible tissue: Callus, score: 21.12	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003749596	2.89E-06	1.36E-07	mr1358	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003749596	NA	2.19E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1003749596:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact