\
| Variant ID: vg1003749596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3749596 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CATTCACACACACCAAAGCATGAGCTGAATTACAAGAGGCTCTAGTGTACTTTATTGTATATTAGAATAGGGAGAGAGTACGGTAGAAGGAATCGGAGGA[A/G]
TCCTGGAGTTGTCGATAATCTCTTCTTATCTTTTGTATCTTGTTAATTACTCTGCTTTAATAGAAATATCATTTTGAGTAATTAAGATTTGCTTAGTGAG
CTCACTAAGCAAATCTTAATTACTCAAAATGATATTTCTATTAAAGCAGAGTAATTAACAAGATACAAAAGATAAGAAGAGATTATCGACAACTCCAGGA[T/C]
TCCTCCGATTCCTTCTACCGTACTCTCTCCCTATTCTAATATACAATAAAGTACACTAGAGCCTCTTGTAATTCAGCTCATGCTTTGGTGTGTGTGAATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.20% | 6.20% | 2.54% | 15.15% | NA |
| All Indica | 2759 | 67.50% | 3.30% | 3.95% | 25.26% | NA |
| All Japonica | 1512 | 90.20% | 9.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.20% | 0.37% | 0.37% | NA |
| Indica I | 595 | 84.00% | 0.00% | 1.85% | 14.12% | NA |
| Indica II | 465 | 75.30% | 1.50% | 3.44% | 19.78% | NA |
| Indica III | 913 | 44.40% | 7.20% | 6.02% | 42.39% | NA |
| Indica Intermediate | 786 | 77.40% | 2.20% | 3.44% | 17.05% | NA |
| Temperate Japonica | 767 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 10.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 23.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 38.50% | 39.60% | 9.38% | 12.50% | NA |
| Intermediate | 90 | 82.20% | 10.00% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003749596 | A -> G | LOC_Os10g07130.1 | upstream_gene_variant ; 3447.0bp to feature; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 21.12 | N | N | N | N |
| vg1003749596 | A -> G | LOC_Os10g07150.2 | downstream_gene_variant ; 582.0bp to feature; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 21.12 | N | N | N | N |
| vg1003749596 | A -> G | LOC_Os10g07150.1 | downstream_gene_variant ; 582.0bp to feature; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 21.12 | N | N | N | N |
| vg1003749596 | A -> G | LOC_Os10g07130-LOC_Os10g07150 | intergenic_region ; MODIFIER | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 21.12 | N | N | N | N |
| vg1003749596 | A -> DEL | N | N | silent_mutation | Average:10.643; most accessible tissue: Callus, score: 21.12 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003749596 | 2.89E-06 | 1.36E-07 | mr1358 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003749596 | NA | 2.19E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |