\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003735124:

Variant ID: vg1003735124 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3735124
Reference Allele: CAlternative Allele: T,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


CAGAATTTTCTACTCCCTTTTTATCCTTAATTTTTAAATCAAATTCTTAGAGCAGCAAAATCCATCATAAGAGACATGGTTTAGCATCTTTCTTAGTGAG[C/T,G]
AGGTATTTTAGAGCAACATGATTAGTATAAACTATTACCTTAGCTCCCACCAAGTAAGATCTAAACTTATCGATAGCAAAAACAACCGCGAGCAGTTCCT

Reverse complement sequence

AGGAACTGCTCGCGGTTGTTTTTGCTATCGATAAGTTTAGATCTTACTTGGTGGGAGCTAAGGTAATAGTTTATACTAATCATGTTGCTCTAAAATACCT[G/A,C]
CTCACTAAGAAAGATGCTAAACCATGTCTCTTATGATGGATTTTGCTGCTCTAAGAATTTGATTTAAAAATTAAGGATAAAAAGGGAGTAGAAAATTCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 31.80% 0.63% 17.90% NA
All Indica  2759 51.80% 17.80% 1.01% 29.39% NA
All Japonica  1512 40.00% 59.90% 0.00% 0.13% NA
Aus  269 88.10% 10.80% 0.00% 1.12% NA
Indica I  595 66.10% 17.60% 0.17% 16.13% NA
Indica II  465 62.60% 12.50% 1.51% 23.44% NA
Indica III  913 30.00% 20.30% 1.20% 48.52% NA
Indica Intermediate  786 60.10% 18.10% 1.15% 20.74% NA
Temperate Japonica  767 11.70% 88.10% 0.00% 0.13% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 37.30% 62.20% 0.00% 0.41% NA
VI/Aromatic  96 25.00% 49.00% 1.04% 25.00% NA
Intermediate  90 58.90% 33.30% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003735124 C -> G LOC_Os10g07090.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER N Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> G LOC_Os10g07100.1 upstream_gene_variant ; 517.0bp to feature; MODIFIER N Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> G LOC_Os10g07110.1 upstream_gene_variant ; 2956.0bp to feature; MODIFIER N Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> G LOC_Os10g07080.1 downstream_gene_variant ; 4759.0bp to feature; MODIFIER N Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> G LOC_Os10g07090-LOC_Os10g07100 intergenic_region ; MODIFIER N Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> T LOC_Os10g07090.1 upstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> T LOC_Os10g07100.1 upstream_gene_variant ; 517.0bp to feature; MODIFIER silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> T LOC_Os10g07110.1 upstream_gene_variant ; 2956.0bp to feature; MODIFIER silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> T LOC_Os10g07080.1 downstream_gene_variant ; 4759.0bp to feature; MODIFIER silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> T LOC_Os10g07090-LOC_Os10g07100 intergenic_region ; MODIFIER silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N
vg1003735124 C -> DEL N N silent_mutation Average:6.172; most accessible tissue: Callus, score: 14.839 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003735124 NA 5.48E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 4.71E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 8.73E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 5.49E-06 NA mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 3.21E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 1.14E-06 NA mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 6.19E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 4.11E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 2.87E-06 NA mr1535 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 2.72E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 3.95E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 1.77E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 3.80E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 7.36E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 2.45E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 2.32E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 7.45E-06 NA mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 4.83E-06 NA mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735124 NA 3.28E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251