\
| Variant ID: vg1003735124 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3735124 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 186. )
CAGAATTTTCTACTCCCTTTTTATCCTTAATTTTTAAATCAAATTCTTAGAGCAGCAAAATCCATCATAAGAGACATGGTTTAGCATCTTTCTTAGTGAG[C/T,G]
AGGTATTTTAGAGCAACATGATTAGTATAAACTATTACCTTAGCTCCCACCAAGTAAGATCTAAACTTATCGATAGCAAAAACAACCGCGAGCAGTTCCT
AGGAACTGCTCGCGGTTGTTTTTGCTATCGATAAGTTTAGATCTTACTTGGTGGGAGCTAAGGTAATAGTTTATACTAATCATGTTGCTCTAAAATACCT[G/A,C]
CTCACTAAGAAAGATGCTAAACCATGTCTCTTATGATGGATTTTGCTGCTCTAAGAATTTGATTTAAAAATTAAGGATAAAAAGGGAGTAGAAAATTCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 31.80% | 0.63% | 17.90% | NA |
| All Indica | 2759 | 51.80% | 17.80% | 1.01% | 29.39% | NA |
| All Japonica | 1512 | 40.00% | 59.90% | 0.00% | 0.13% | NA |
| Aus | 269 | 88.10% | 10.80% | 0.00% | 1.12% | NA |
| Indica I | 595 | 66.10% | 17.60% | 0.17% | 16.13% | NA |
| Indica II | 465 | 62.60% | 12.50% | 1.51% | 23.44% | NA |
| Indica III | 913 | 30.00% | 20.30% | 1.20% | 48.52% | NA |
| Indica Intermediate | 786 | 60.10% | 18.10% | 1.15% | 20.74% | NA |
| Temperate Japonica | 767 | 11.70% | 88.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 37.30% | 62.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 25.00% | 49.00% | 1.04% | 25.00% | NA |
| Intermediate | 90 | 58.90% | 33.30% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003735124 | C -> G | LOC_Os10g07090.1 | upstream_gene_variant ; 472.0bp to feature; MODIFIER | N | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> G | LOC_Os10g07100.1 | upstream_gene_variant ; 517.0bp to feature; MODIFIER | N | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> G | LOC_Os10g07110.1 | upstream_gene_variant ; 2956.0bp to feature; MODIFIER | N | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> G | LOC_Os10g07080.1 | downstream_gene_variant ; 4759.0bp to feature; MODIFIER | N | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> G | LOC_Os10g07090-LOC_Os10g07100 | intergenic_region ; MODIFIER | N | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> T | LOC_Os10g07090.1 | upstream_gene_variant ; 472.0bp to feature; MODIFIER | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> T | LOC_Os10g07100.1 | upstream_gene_variant ; 517.0bp to feature; MODIFIER | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> T | LOC_Os10g07110.1 | upstream_gene_variant ; 2956.0bp to feature; MODIFIER | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> T | LOC_Os10g07080.1 | downstream_gene_variant ; 4759.0bp to feature; MODIFIER | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> T | LOC_Os10g07090-LOC_Os10g07100 | intergenic_region ; MODIFIER | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| vg1003735124 | C -> DEL | N | N | silent_mutation | Average:6.172; most accessible tissue: Callus, score: 14.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003735124 | NA | 5.48E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 4.71E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 8.73E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | 5.49E-06 | NA | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 3.21E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | 1.14E-06 | NA | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 6.19E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 4.11E-06 | mr1495 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | 2.87E-06 | NA | mr1535 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 2.72E-10 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 3.95E-06 | mr1603 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 1.77E-06 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 3.80E-07 | mr1733 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 7.36E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 2.45E-13 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 2.32E-09 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | 7.45E-06 | NA | mr1950 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | 4.83E-06 | NA | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003735124 | NA | 3.28E-07 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |