\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003735001:

Variant ID: vg1003735001 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3735001
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TCACTATGTTGGCATACCACGGGTTGGAGTCGCGAACTGTCATCAGCATGTCATCTCTCAAGGAATCATTTATCGGCTATTCCTGCGTGCCAGTGATTTG[C/T]
AGCCTAGACAAATGATCTGCTACAGAATTTTCTACTCCCTTTTTATCCTTAATTTTTAAATCAAATTCTTAGAGCAGCAAAATCCATCATAAGAGACATG

Reverse complement sequence

CATGTCTCTTATGATGGATTTTGCTGCTCTAAGAATTTGATTTAAAAATTAAGGATAAAAAGGGAGTAGAAAATTCTGTAGCAGATCATTTGTCTAGGCT[G/A]
CAAATCACTGGCACGCAGGAATAGCCGATAAATGATTCCTTGAGAGATGACATGCTGATGACAGTTCGCGACTCCAACCCGTGGTATGCCAACATAGTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 31.70% 0.34% 18.28% NA
All Indica  2759 51.80% 17.60% 0.51% 30.08% NA
All Japonica  1512 40.10% 59.80% 0.00% 0.13% NA
Aus  269 87.70% 11.20% 0.00% 1.12% NA
Indica I  595 66.20% 17.60% 0.17% 15.97% NA
Indica II  465 62.80% 12.00% 0.22% 24.95% NA
Indica III  913 30.10% 19.70% 0.66% 49.51% NA
Indica Intermediate  786 59.70% 18.30% 0.76% 21.25% NA
Temperate Japonica  767 11.70% 88.10% 0.00% 0.13% NA
Tropical Japonica  504 84.50% 15.50% 0.00% 0.00% NA
Japonica Intermediate  241 37.30% 62.20% 0.00% 0.41% NA
VI/Aromatic  96 25.00% 50.00% 2.08% 22.92% NA
Intermediate  90 56.70% 35.60% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003735001 C -> T LOC_Os10g07090.1 upstream_gene_variant ; 349.0bp to feature; MODIFIER silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N
vg1003735001 C -> T LOC_Os10g07100.1 upstream_gene_variant ; 640.0bp to feature; MODIFIER silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N
vg1003735001 C -> T LOC_Os10g07110.1 upstream_gene_variant ; 3079.0bp to feature; MODIFIER silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N
vg1003735001 C -> T LOC_Os10g07080.1 downstream_gene_variant ; 4636.0bp to feature; MODIFIER silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N
vg1003735001 C -> T LOC_Os10g07090-LOC_Os10g07100 intergenic_region ; MODIFIER silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N
vg1003735001 C -> DEL N N silent_mutation Average:14.576; most accessible tissue: Callus, score: 33.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003735001 4.90E-06 NA mr1042 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 5.71E-06 NA mr1047 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 5.48E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 4.71E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 8.73E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 3.08E-06 NA mr1143 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 3.21E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 4.05E-07 NA mr1167 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 8.17E-06 mr1326 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 6.19E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 4.11E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 3.84E-06 NA mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 2.72E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 3.95E-06 mr1603 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 8.53E-06 NA mr1675 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 1.77E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 3.80E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 7.36E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 2.45E-13 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 2.64E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 2.32E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 3.36E-06 NA mr1950 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 2.88E-06 NA mr1969 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001 NA 3.28E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251