Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003735001:

Variant ID: vg1003735001 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3735001
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TCACTATGTTGGCATACCACGGGTTGGAGTCGCGAACTGTCATCAGCATGTCATCTCTCAAGGAATCATTTATCGGCTATTCCTGCGTGCCAGTGATTTG[C/T]
AGCCTAGACAAATGATCTGCTACAGAATTTTCTACTCCCTTTTTATCCTTAATTTTTAAATCAAATTCTTAGAGCAGCAAAATCCATCATAAGAGACATG

Reverse complement sequence

CATGTCTCTTATGATGGATTTTGCTGCTCTAAGAATTTGATTTAAAAATTAAGGATAAAAAGGGAGTAGAAAATTCTGTAGCAGATCATTTGTCTAGGCT[G/A]
CAAATCACTGGCACGCAGGAATAGCCGATAAATGATTCCTTGAGAGATGACATGCTGATGACAGTTCGCGACTCCAACCCGTGGTATGCCAACATAGTGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	31.70%	0.34%	18.28%	NA
All Indica	2759	51.80%	17.60%	0.51%	30.08%	NA
All Japonica	1512	40.10%	59.80%	0.00%	0.13%	NA
Aus	269	87.70%	11.20%	0.00%	1.12%	NA
Indica I	595	66.20%	17.60%	0.17%	15.97%	NA
Indica II	465	62.80%	12.00%	0.22%	24.95%	NA
Indica III	913	30.10%	19.70%	0.66%	49.51%	NA
Indica Intermediate	786	59.70%	18.30%	0.76%	21.25%	NA
Temperate Japonica	767	11.70%	88.10%	0.00%	0.13%	NA
Tropical Japonica	504	84.50%	15.50%	0.00%	0.00%	NA
Japonica Intermediate	241	37.30%	62.20%	0.00%	0.41%	NA
VI/Aromatic	96	25.00%	50.00%	2.08%	22.92%	NA
Intermediate	90	56.70%	35.60%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003735001	C -> T	LOC_Os10g07090.1	upstream_gene_variant ; 349.0bp to feature; MODIFIER	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N
vg1003735001	C -> T	LOC_Os10g07100.1	upstream_gene_variant ; 640.0bp to feature; MODIFIER	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N
vg1003735001	C -> T	LOC_Os10g07110.1	upstream_gene_variant ; 3079.0bp to feature; MODIFIER	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N
vg1003735001	C -> T	LOC_Os10g07080.1	downstream_gene_variant ; 4636.0bp to feature; MODIFIER	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N
vg1003735001	C -> T	LOC_Os10g07090-LOC_Os10g07100	intergenic_region ; MODIFIER	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N
vg1003735001	C -> DEL	N	N	silent_mutation	Average:14.576; most accessible tissue: Callus, score: 33.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003735001	4.90E-06	NA	mr1042	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	5.71E-06	NA	mr1047	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	5.48E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	4.71E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	8.73E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	3.08E-06	NA	mr1143	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	3.21E-06	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	4.05E-07	NA	mr1167	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	8.17E-06	mr1326	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	6.19E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	4.11E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	3.84E-06	NA	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	2.72E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	3.95E-06	mr1603	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	8.53E-06	NA	mr1675	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	1.77E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	3.80E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	7.36E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	2.45E-13	mr1771	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	2.64E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	2.32E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	3.36E-06	NA	mr1950	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	2.88E-06	NA	mr1969	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003735001	NA	3.28E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251