Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003725962:

Variant ID: vg1003725962 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3725962
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, G: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGCCGTTTCGTCGATCCGCTGTTGCTTGAAGACGTTGCTGTGGTCTCATCAGTGTGAGAGCAAGGCAAGTCATATATTACAATTGATCATATTGTACC[T/C,G]
AATTTACAAATGTCCCGCATTTCTATTAAATATTGCATTGTTTTACAATATCATGTGGGATGGGTTATACTACTCAGCCATATATTGTTTACCTTATGCC

Reverse complement sequence

GGCATAAGGTAAACAATATATGGCTGAGTAGTATAACCCATCCCACATGATATTGTAAAACAATGCAATATTTAATAGAAATGCGGGACATTTGTAAATT[A/G,C]
GGTACAATATGATCAATTGTAATATATGACTTGCCTTGCTCTCACACTGATGAGACCACAGCAACGTCTTCAAGCAACAGCGGATCGACGAAACGGCCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.20%	39.70%	0.85%	18.26%	G: 0.04%
All Indica	2759	48.70%	20.00%	1.12%	30.12%	G: 0.07%
All Japonica	1512	25.00%	74.90%	0.07%	0.07%	NA
Aus	269	68.40%	29.70%	1.86%	0.00%	NA
Indica I	595	65.90%	17.60%	0.17%	16.30%	NA
Indica II	465	33.10%	41.30%	0.43%	25.16%	NA
Indica III	913	38.40%	10.70%	2.52%	48.19%	G: 0.11%
Indica Intermediate	786	56.90%	19.80%	0.64%	22.52%	G: 0.13%
Temperate Japonica	767	5.10%	94.80%	0.00%	0.13%	NA
Tropical Japonica	504	60.10%	39.90%	0.00%	0.00%	NA
Japonica Intermediate	241	14.90%	84.60%	0.41%	0.00%	NA
VI/Aromatic	96	1.00%	70.80%	3.12%	25.00%	NA
Intermediate	90	43.30%	48.90%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003725962	T -> C	LOC_Os10g07080.1	upstream_gene_variant ; 2003.0bp to feature; MODIFIER	silent_mutation	Average:9.054; most accessible tissue: Callus, score: 39.658	N	N	N	N
vg1003725962	T -> C	LOC_Os10g07060-LOC_Os10g07080	intergenic_region ; MODIFIER	silent_mutation	Average:9.054; most accessible tissue: Callus, score: 39.658	N	N	N	N
vg1003725962	T -> G	LOC_Os10g07080.1	upstream_gene_variant ; 2003.0bp to feature; MODIFIER	silent_mutation	Average:9.054; most accessible tissue: Callus, score: 39.658	N	N	N	N
vg1003725962	T -> G	LOC_Os10g07060-LOC_Os10g07080	intergenic_region ; MODIFIER	silent_mutation	Average:9.054; most accessible tissue: Callus, score: 39.658	N	N	N	N
vg1003725962	T -> DEL	N	N	silent_mutation	Average:9.054; most accessible tissue: Callus, score: 39.658	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003725962	NA	2.53E-07	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1003725962	NA	7.48E-08	mr1073	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	7.46E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	5.46E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	9.89E-06	mr1262	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	3.13E-07	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	3.05E-06	3.05E-06	mr1307	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	7.26E-06	3.05E-07	mr1407	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	3.39E-06	mr1414	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	2.37E-07	mr1554	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	3.80E-06	mr1606	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	3.63E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	4.74E-07	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003725962	NA	2.23E-08	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251