Variant ID: vg1003720429 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 3720429 |
Reference Allele: A | Alternative Allele: T |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGATCTAATTTGTGTAATAAATTTTTTAAGCCTAATTAATCTATAATTAGCACATATTTACTGTAGCATCACATAGGCTAATCATGGATTAATTAGGT[A/T]
CAATAGATTTATCTCGTGAGTTAGGCTAAGATTATAGAATTGGTTTTATCAATAATCTATGTTTAATACTTCTAATTATTACCAAATATCCGATCTGATA
TATCAGATCGGATATTTGGTAATAATTAGAAGTATTAAACATAGATTATTGATAAAACCAATTCTATAATCTTAGCCTAACTCACGAGATAAATCTATTG[T/A]
ACCTAATTAATCCATGATTAGCCTATGTGATGCTACAGTAAATATGTGCTAATTATAGATTAATTAGGCTTAAAAAATTTATTACACAAATTAGATCTTA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 29.50% | 11.30% | 0.80% | 58.36% | NA |
All Indica | 2759 | 12.10% | 5.30% | 0.51% | 82.06% | NA |
All Japonica | 1512 | 59.60% | 19.30% | 1.32% | 19.78% | NA |
Aus | 269 | 35.70% | 4.50% | 1.12% | 58.74% | NA |
Indica I | 595 | 4.00% | 0.00% | 0.50% | 95.46% | NA |
Indica II | 465 | 32.00% | 0.60% | 0.43% | 66.88% | NA |
Indica III | 913 | 8.70% | 11.80% | 0.44% | 79.08% | NA |
Indica Intermediate | 786 | 10.60% | 4.50% | 0.64% | 84.35% | NA |
Temperate Japonica | 767 | 88.00% | 11.00% | 0.39% | 0.65% | NA |
Tropical Japonica | 504 | 24.80% | 20.20% | 0.79% | 54.17% | NA |
Japonica Intermediate | 241 | 41.90% | 44.00% | 5.39% | 8.71% | NA |
VI/Aromatic | 96 | 31.20% | 68.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 37.80% | 20.00% | 1.11% | 41.11% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1003720429 | A -> T | LOC_Os10g07060.1 | downstream_gene_variant ; 3180.0bp to feature; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 84.576 | N | N | N | N |
vg1003720429 | A -> T | LOC_Os10g07060-LOC_Os10g07080 | intergenic_region ; MODIFIER | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 84.576 | N | N | N | N |
vg1003720429 | A -> DEL | N | N | silent_mutation | Average:12.192; most accessible tissue: Callus, score: 84.576 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1003720429 | 2.22E-07 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg1003720429 | NA | 5.36E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |