Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003719342:

Variant ID: vg1003719342 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3719342
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CTATACTCCCTGCAAAAAAAAAACTGCGAGCCCTCGCCTCGCAGTCGCAGGCAAAAGCGAGAAAGTTGGCAACCTGCCACTGTCAGCAGCAACAAGGACG[G/A]
AGGAGAGGAGGGAAGGAGCAGAGCTATTATCGCTACGTCCACCAAACGACAAGCAACAAAGCAGCAAGTGCATGACATTTGTGGTTCTGTACGCCTAGAA

Reverse complement sequence

TTCTAGGCGTACAGAACCACAAATGTCATGCACTTGCTGCTTTGTTGCTTGTCGTTTGGTGGACGTAGCGATAATAGCTCTGCTCCTTCCCTCCTCTCCT[C/T]
CGTCCTTGTTGCTGCTGACAGTGGCAGGTTGCCAACTTTCTCGCTTTTGCCTGCGACTGCGAGGCGAGGGCTCGCAGTTTTTTTTTTGCAGGGAGTATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	1.10%	0.44%	21.98%	NA
All Indica	2759	61.90%	0.00%	0.76%	37.33%	NA
All Japonica	1512	96.50%	3.40%	0.00%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	67.60%	0.00%	1.18%	31.26%	NA
Indica II	465	66.20%	0.00%	0.86%	32.90%	NA
Indica III	913	50.70%	0.00%	0.44%	48.85%	NA
Indica Intermediate	786	67.90%	0.10%	0.76%	31.17%	NA
Temperate Japonica	767	95.70%	4.20%	0.00%	0.13%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	0.00%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003719342	G -> A	LOC_Os10g07060.1	downstream_gene_variant ; 2093.0bp to feature; MODIFIER	silent_mutation	Average:17.889; most accessible tissue: Callus, score: 93.848	N	N	N	N
vg1003719342	G -> A	LOC_Os10g07060-LOC_Os10g07080	intergenic_region ; MODIFIER	silent_mutation	Average:17.889; most accessible tissue: Callus, score: 93.848	N	N	N	N
vg1003719342	G -> DEL	N	N	silent_mutation	Average:17.889; most accessible tissue: Callus, score: 93.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003719342	NA	8.31E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	5.52E-07	3.97E-06	mr1280	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	6.44E-06	6.44E-06	mr1284	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	9.08E-06	9.08E-06	mr1288	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	3.10E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	5.52E-06	5.52E-06	mr1307	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	8.48E-06	8.48E-06	mr1357	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	2.48E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	6.26E-06	mr1380	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	3.26E-06	3.26E-06	mr1393	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	1.82E-07	1.82E-07	mr1407	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	3.21E-09	3.21E-09	mr1505	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	5.22E-08	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	7.51E-06	NA	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	6.52E-06	6.52E-06	mr1710	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	1.26E-06	1.71E-07	mr1736	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	2.74E-06	NA	mr1788	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	6.89E-06	6.89E-06	mr1849	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	3.57E-06	3.57E-06	mr1955	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	7.63E-06	7.63E-06	mr1967	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	3.90E-07	3.90E-07	mr1978	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	1.44E-06	mr1098_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	3.57E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	NA	1.05E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003719342	5.48E-06	5.48E-06	mr1647_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251