\
| Variant ID: vg1003718301 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 3718301 |
| Reference Allele: TGTTTTAA | Alternative Allele: GGTTTTAA,T |
| Primary Allele: TGTTTTAA | Secondary Allele: GGTTTTAA |
Inferred Ancestral Allele: Not determined.
TCACATTGTCGCAATTTCAACTAAACTTCCAATTTCAGTGTGAACTAAACACATTACTACTACTACATTTGTGCCCCTGATAATGTATTCTATTTTGTCT[TGTTTTAA/GGTTTTAA,T]
TTTGTTGCAAGTTATAACTTGATATTTAAGGTCGTGTAAATCAATTTTCTTTACTGACATTTATAGGATGATGACCACGGTGACACTACGGATCGTATAT
ATATACGATCCGTAGTGTCACCGTGGTCATCATCCTATAAATGTCAGTAAAGAAAATTGATTTACACGACCTTAAATATCAAGTTATAACTTGCAACAAA[TTAAAACA/TTAAAACC,A]
AGACAAAATAGAATACATTATCAGGGGCACAAATGTAGTAGTAGTAATGTGTTTAGTTCACACTGAAATTGGAAGTTTAGTTGAAATTGCGACAATGTGA
| Populations | Population Size | Frequency of TGTTTTAA(primary allele) | Frequency of GGTTTTAA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 11.70% | 7.11% | 9.61% | NA |
| All Indica | 2759 | 57.80% | 14.60% | 11.78% | 15.77% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.07% | 0.07% | NA |
| Aus | 269 | 40.10% | 52.00% | 2.60% | 5.20% | NA |
| Indica I | 595 | 38.30% | 30.10% | 16.64% | 14.96% | NA |
| Indica II | 465 | 74.60% | 2.40% | 9.46% | 13.55% | NA |
| Indica III | 913 | 56.00% | 13.30% | 9.97% | 20.81% | NA |
| Indica Intermediate | 786 | 64.90% | 11.70% | 11.58% | 11.83% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 10.00% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003718301 | TGTTTTAA -> GGTTTTAA | LOC_Os10g07060.1 | downstream_gene_variant ; 1052.0bp to feature; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Callus, score: 85.204 | N | N | N | N |
| vg1003718301 | TGTTTTAA -> GGTTTTAA | LOC_Os10g07060-LOC_Os10g07080 | intergenic_region ; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Callus, score: 85.204 | N | N | N | N |
| vg1003718301 | TGTTTTAA -> T | LOC_Os10g07060.1 | downstream_gene_variant ; 1053.0bp to feature; MODIFIER | N | Average:13.166; most accessible tissue: Callus, score: 85.204 | N | N | N | N |
| vg1003718301 | TGTTTTAA -> T | LOC_Os10g07060-LOC_Os10g07080 | intergenic_region ; MODIFIER | N | Average:13.166; most accessible tissue: Callus, score: 85.204 | N | N | N | N |
| vg1003718301 | TGTTTTAA -> DEL | N | N | silent_mutation | Average:13.166; most accessible tissue: Callus, score: 85.204 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003718301 | NA | 1.08E-06 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003718301 | NA | 8.61E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003718301 | NA | 4.19E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003718301 | 6.55E-06 | 3.59E-10 | mr1538_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003718301 | NA | 2.01E-08 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003718301 | NA | 1.27E-12 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |