\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003718301:

Variant ID: vg1003718301 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 3718301
Reference Allele: TGTTTTAAAlternative Allele: GGTTTTAA,T
Primary Allele: TGTTTTAASecondary Allele: GGTTTTAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCACATTGTCGCAATTTCAACTAAACTTCCAATTTCAGTGTGAACTAAACACATTACTACTACTACATTTGTGCCCCTGATAATGTATTCTATTTTGTCT[TGTTTTAA/GGTTTTAA,T]
TTTGTTGCAAGTTATAACTTGATATTTAAGGTCGTGTAAATCAATTTTCTTTACTGACATTTATAGGATGATGACCACGGTGACACTACGGATCGTATAT

Reverse complement sequence

ATATACGATCCGTAGTGTCACCGTGGTCATCATCCTATAAATGTCAGTAAAGAAAATTGATTTACACGACCTTAAATATCAAGTTATAACTTGCAACAAA[TTAAAACA/TTAAAACC,A]
AGACAAAATAGAATACATTATCAGGGGCACAAATGTAGTAGTAGTAATGTGTTTAGTTCACACTGAAATTGGAAGTTTAGTTGAAATTGCGACAATGTGA

Allele Frequencies:

Populations Population SizeFrequency of TGTTTTAA(primary allele) Frequency of GGTTTTAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 11.70% 7.11% 9.61% NA
All Indica  2759 57.80% 14.60% 11.78% 15.77% NA
All Japonica  1512 99.70% 0.10% 0.07% 0.07% NA
Aus  269 40.10% 52.00% 2.60% 5.20% NA
Indica I  595 38.30% 30.10% 16.64% 14.96% NA
Indica II  465 74.60% 2.40% 9.46% 13.55% NA
Indica III  913 56.00% 13.30% 9.97% 20.81% NA
Indica Intermediate  786 64.90% 11.70% 11.58% 11.83% NA
Temperate Japonica  767 99.70% 0.10% 0.00% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 10.00% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003718301 TGTTTTAA -> GGTTTTAA LOC_Os10g07060.1 downstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:13.166; most accessible tissue: Callus, score: 85.204 N N N N
vg1003718301 TGTTTTAA -> GGTTTTAA LOC_Os10g07060-LOC_Os10g07080 intergenic_region ; MODIFIER silent_mutation Average:13.166; most accessible tissue: Callus, score: 85.204 N N N N
vg1003718301 TGTTTTAA -> T LOC_Os10g07060.1 downstream_gene_variant ; 1053.0bp to feature; MODIFIER N Average:13.166; most accessible tissue: Callus, score: 85.204 N N N N
vg1003718301 TGTTTTAA -> T LOC_Os10g07060-LOC_Os10g07080 intergenic_region ; MODIFIER N Average:13.166; most accessible tissue: Callus, score: 85.204 N N N N
vg1003718301 TGTTTTAA -> DEL N N silent_mutation Average:13.166; most accessible tissue: Callus, score: 85.204 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003718301 NA 1.08E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003718301 NA 8.61E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003718301 NA 4.19E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003718301 6.55E-06 3.59E-10 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003718301 NA 2.01E-08 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003718301 NA 1.27E-12 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251