Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003688387:

Variant ID: vg1003688387 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3688387
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAGGTTGGCAGCAGACTCAATACCGAGTTTTTTGTGTTCTGAACTCTAAACTCTTTTCTTTGGCTATAGATATCGGCGAACCATCACGATAAAAATTT[T/A]
GATCGGGCAAAGCTAGAACTAGGGAAGAATGAAAAGCTTGAGGTGACAGAATGTTACAGATAATTTTTTACTCACTGCTACAGAATACTAAATGGGTGCC

Reverse complement sequence

GGCACCCATTTAGTATTCTGTAGCAGTGAGTAAAAAATTATCTGTAACATTCTGTCACCTCAAGCTTTTCATTCTTCCCTAGTTCTAGCTTTGCCCGATC[A/T]
AAATTTTTATCGTGATGGTTCGCCGATATCTATAGCCAAAGAAAAGAGTTTAGAGTTCAGAACACAAAAAACTCGGTATTGAGTCTGCTGCCAACCTCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	10.10%	0.02%	0.00%	NA
All Indica	2759	88.40%	11.50%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	43.50%	56.50%	0.00%	0.00%	NA
Indica I	595	70.10%	29.90%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	94.50%	5.40%	0.11%	0.00%	NA
Indica Intermediate	786	88.80%	11.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003688387	T -> A	LOC_Os10g07030.1	upstream_gene_variant ; 2585.0bp to feature; MODIFIER	silent_mutation	Average:37.808; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N
vg1003688387	T -> A	LOC_Os10g07030-LOC_Os10g07040	intergenic_region ; MODIFIER	silent_mutation	Average:37.808; most accessible tissue: Zhenshan97 flower, score: 49.187	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003688387	NA	7.42E-06	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	2.68E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	4.48E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	4.02E-06	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	4.68E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	2.22E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	1.39E-09	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	2.72E-09	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	NA	9.03E-09	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	1.31E-09	4.81E-10	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003688387	9.22E-10	7.24E-17	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251