\
| Variant ID: vg1003688387 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3688387 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 259. )
GGGAGGTTGGCAGCAGACTCAATACCGAGTTTTTTGTGTTCTGAACTCTAAACTCTTTTCTTTGGCTATAGATATCGGCGAACCATCACGATAAAAATTT[T/A]
GATCGGGCAAAGCTAGAACTAGGGAAGAATGAAAAGCTTGAGGTGACAGAATGTTACAGATAATTTTTTACTCACTGCTACAGAATACTAAATGGGTGCC
GGCACCCATTTAGTATTCTGTAGCAGTGAGTAAAAAATTATCTGTAACATTCTGTCACCTCAAGCTTTTCATTCTTCCCTAGTTCTAGCTTTGCCCGATC[A/T]
AAATTTTTATCGTGATGGTTCGCCGATATCTATAGCCAAAGAAAAGAGTTTAGAGTTCAGAACACAAAAAACTCGGTATTGAGTCTGCTGCCAACCTCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 88.40% | 11.50% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 43.50% | 56.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.10% | 29.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.50% | 5.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003688387 | T -> A | LOC_Os10g07030.1 | upstream_gene_variant ; 2585.0bp to feature; MODIFIER | silent_mutation | Average:37.808; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| vg1003688387 | T -> A | LOC_Os10g07030-LOC_Os10g07040 | intergenic_region ; MODIFIER | silent_mutation | Average:37.808; most accessible tissue: Zhenshan97 flower, score: 49.187 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003688387 | NA | 7.42E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 2.68E-06 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 4.48E-06 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 4.02E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 4.68E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 2.22E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 1.39E-09 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 2.72E-09 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | NA | 9.03E-09 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | 1.31E-09 | 4.81E-10 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003688387 | 9.22E-10 | 7.24E-17 | mr1709_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |