\
| Variant ID: vg1003663158 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3663158 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 128. )
GTAATTAGTATTCCATAAAACAATAATCTCCAAAACTAAGTTTATCATTATAAAAAGGAAAAAATATGAATTAACCCCTGAACGGTTGCGATCATCCGAA[T/C]
TACACCTGTAATTTGAATACTAAACATTTAAGTTCCATCAACTATCTAAACTGGACAAACCGACTCAATCCCAAGAGGTTTTGGTCTAACGTGGCAGTTC
GAACTGCCACGTTAGACCAAAACCTCTTGGGATTGAGTCGGTTTGTCCAGTTTAGATAGTTGATGGAACTTAAATGTTTAGTATTCAAATTACAGGTGTA[A/G]
TTCGGATGATCGCAACCGTTCAGGGGTTAATTCATATTTTTTCCTTTTTATAATGATAAACTTAGTTTTGGAGATTATTGTTTTATGGAATACTAATTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 4.30% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 7.30% | 1.34% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.70% | 15.30% | 3.03% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 94.00% | 5.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 91.30% | 7.00% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003663158 | T -> C | LOC_Os10g07010.1 | upstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg1003663158 | T -> C | LOC_Os10g07010-LOC_Os10g07030 | intergenic_region ; MODIFIER | silent_mutation | Average:44.192; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003663158 | 2.04E-07 | NA | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | 1.72E-06 | NA | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | 1.07E-08 | 1.37E-06 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | 5.74E-07 | NA | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | NA | 7.01E-06 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | NA | 1.52E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | 1.19E-10 | NA | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003663158 | 1.96E-07 | NA | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |