\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003625172:

Variant ID: vg1003625172 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3625172
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.32, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGAACTTGTCAATTCTGTCGGATATATCGTGGCCACTGTCTAAATCAATTTAACATTCCGCTTCAGATGTCTTGGAACTAATTACTCTCTCCGTCC[T/C]
ATTTTAAACCTAGTCATAAATTTTCGGATCCAACTTTAATTATATATGTCTTAATTAAAATTTTTTGAAAAAATTAAAAAACATAAGTCACGCGTACTAT

Reverse complement sequence

ATAGTACGCGTGACTTATGTTTTTTAATTTTTTCAAAAAATTTTAATTAAGACATATATAATTAAAGTTGGATCCGAAAATTTATGACTAGGTTTAAAAT[A/G]
GGACGGAGAGAGTAATTAGTTCCAAGACATCTGAAGCGGAATGTTAAATTGATTTAGACAGTGGCCACGATATATCCGACAGAATTGACAAGTTCTTCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 28.00% 17.60% 0.34% 54.08% NA
All Indica  2759 43.60% 0.90% 0.43% 55.06% NA
All Japonica  1512 1.90% 51.80% 0.13% 46.16% NA
Aus  269 10.80% 0.40% 0.00% 88.85% NA
Indica I  595 35.50% 2.50% 0.00% 62.02% NA
Indica II  465 38.10% 0.60% 0.65% 60.65% NA
Indica III  913 54.90% 0.00% 0.33% 44.80% NA
Indica Intermediate  786 39.90% 0.90% 0.76% 58.40% NA
Temperate Japonica  767 0.70% 86.60% 0.13% 12.65% NA
Tropical Japonica  504 1.20% 6.70% 0.00% 92.06% NA
Japonica Intermediate  241 7.50% 35.30% 0.41% 56.85% NA
VI/Aromatic  96 36.50% 8.30% 1.04% 54.17% NA
Intermediate  90 30.00% 15.60% 1.11% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003625172 T -> C LOC_Os10g06950.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:31.223; most accessible tissue: Callus, score: 42.405 N N N N
vg1003625172 T -> C LOC_Os10g06960.1 upstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:31.223; most accessible tissue: Callus, score: 42.405 N N N N
vg1003625172 T -> C LOC_Os10g06970.1 downstream_gene_variant ; 4226.0bp to feature; MODIFIER silent_mutation Average:31.223; most accessible tissue: Callus, score: 42.405 N N N N
vg1003625172 T -> C LOC_Os10g06950-LOC_Os10g06960 intergenic_region ; MODIFIER silent_mutation Average:31.223; most accessible tissue: Callus, score: 42.405 N N N N
vg1003625172 T -> DEL N N silent_mutation Average:31.223; most accessible tissue: Callus, score: 42.405 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003625172 NA 3.87E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 3.04E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 2.52E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 7.00E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 2.04E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 1.81E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 2.58E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 2.73E-06 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 7.69E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 3.64E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 3.27E-06 4.74E-16 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003625172 NA 1.67E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251