\
| Variant ID: vg1003625172 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3625172 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.32, others allele: 0.00, population size: 90. )
TAGAAGAACTTGTCAATTCTGTCGGATATATCGTGGCCACTGTCTAAATCAATTTAACATTCCGCTTCAGATGTCTTGGAACTAATTACTCTCTCCGTCC[T/C]
ATTTTAAACCTAGTCATAAATTTTCGGATCCAACTTTAATTATATATGTCTTAATTAAAATTTTTTGAAAAAATTAAAAAACATAAGTCACGCGTACTAT
ATAGTACGCGTGACTTATGTTTTTTAATTTTTTCAAAAAATTTTAATTAAGACATATATAATTAAAGTTGGATCCGAAAATTTATGACTAGGTTTAAAAT[A/G]
GGACGGAGAGAGTAATTAGTTCCAAGACATCTGAAGCGGAATGTTAAATTGATTTAGACAGTGGCCACGATATATCCGACAGAATTGACAAGTTCTTCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.00% | 17.60% | 0.34% | 54.08% | NA |
| All Indica | 2759 | 43.60% | 0.90% | 0.43% | 55.06% | NA |
| All Japonica | 1512 | 1.90% | 51.80% | 0.13% | 46.16% | NA |
| Aus | 269 | 10.80% | 0.40% | 0.00% | 88.85% | NA |
| Indica I | 595 | 35.50% | 2.50% | 0.00% | 62.02% | NA |
| Indica II | 465 | 38.10% | 0.60% | 0.65% | 60.65% | NA |
| Indica III | 913 | 54.90% | 0.00% | 0.33% | 44.80% | NA |
| Indica Intermediate | 786 | 39.90% | 0.90% | 0.76% | 58.40% | NA |
| Temperate Japonica | 767 | 0.70% | 86.60% | 0.13% | 12.65% | NA |
| Tropical Japonica | 504 | 1.20% | 6.70% | 0.00% | 92.06% | NA |
| Japonica Intermediate | 241 | 7.50% | 35.30% | 0.41% | 56.85% | NA |
| VI/Aromatic | 96 | 36.50% | 8.30% | 1.04% | 54.17% | NA |
| Intermediate | 90 | 30.00% | 15.60% | 1.11% | 53.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003625172 | T -> C | LOC_Os10g06950.1 | upstream_gene_variant ; 3569.0bp to feature; MODIFIER | silent_mutation | Average:31.223; most accessible tissue: Callus, score: 42.405 | N | N | N | N |
| vg1003625172 | T -> C | LOC_Os10g06960.1 | upstream_gene_variant ; 2772.0bp to feature; MODIFIER | silent_mutation | Average:31.223; most accessible tissue: Callus, score: 42.405 | N | N | N | N |
| vg1003625172 | T -> C | LOC_Os10g06970.1 | downstream_gene_variant ; 4226.0bp to feature; MODIFIER | silent_mutation | Average:31.223; most accessible tissue: Callus, score: 42.405 | N | N | N | N |
| vg1003625172 | T -> C | LOC_Os10g06950-LOC_Os10g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:31.223; most accessible tissue: Callus, score: 42.405 | N | N | N | N |
| vg1003625172 | T -> DEL | N | N | silent_mutation | Average:31.223; most accessible tissue: Callus, score: 42.405 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003625172 | NA | 3.87E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 3.04E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 2.52E-22 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 7.00E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 2.04E-09 | mr1580 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 1.81E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 2.58E-06 | mr1668 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 2.73E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 7.69E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 3.64E-08 | mr1825 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | 3.27E-06 | 4.74E-16 | mr1982 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003625172 | NA | 1.67E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |