Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003607263:

Variant ID: vg1003607263 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3607263
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TACAGCACAAAGTGGAAGTGTTACTACATGGCAAGTACACGTTACCACATGTTTATGCAGTAACACTATTCATAAATTGCAGTAAGACACATTGTTACTA[C/T]
AAAACTTATGGTTTTTACTACACACTTACAGTAACGTCACGATGGGATTGTAGTAACGCATAACAGATAGTACTAACAAGTAGTAATGCTATAGTATTAC

Reverse complement sequence

GTAATACTATAGCATTACTACTTGTTAGTACTATCTGTTATGCGTTACTACAATCCCATCGTGACGTTACTGTAAGTGTGTAGTAAAAACCATAAGTTTT[G/A]
TAGTAACAATGTGTCTTACTGCAATTTATGAATAGTGTTACTGCATAAACATGTGGTAACGTGTACTTGCCATGTAGTAACACTTCCACTTTGTGCTGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	25.70%	2.37%	3.72%	NA
All Indica	2759	77.00%	20.00%	2.03%	0.98%	NA
All Japonica	1512	63.80%	25.50%	2.18%	8.47%	NA
Aus	269	11.20%	81.40%	4.46%	2.97%	NA
Indica I	595	69.40%	27.70%	2.69%	0.17%	NA
Indica II	465	69.00%	25.20%	3.66%	2.15%	NA
Indica III	913	83.10%	14.90%	0.77%	1.20%	NA
Indica Intermediate	786	80.30%	17.00%	2.04%	0.64%	NA
Temperate Japonica	767	91.70%	7.60%	0.13%	0.65%	NA
Tropical Japonica	504	28.00%	45.40%	5.95%	20.63%	NA
Japonica Intermediate	241	50.20%	41.10%	0.83%	7.88%	NA
VI/Aromatic	96	55.20%	27.10%	8.33%	9.38%	NA
Intermediate	90	58.90%	33.30%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003607263	C -> T	LOC_Os10g06930.1	upstream_gene_variant ; 4998.0bp to feature; MODIFIER	silent_mutation	Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg1003607263	C -> T	LOC_Os10g06920-LOC_Os10g06930	intergenic_region ; MODIFIER	silent_mutation	Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N
vg1003607263	C -> DEL	N	N	silent_mutation	Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003607263	NA	2.72E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263	NA	1.10E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263	NA	7.27E-08	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263	NA	9.01E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251