\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003607263:

Variant ID: vg1003607263 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3607263
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TACAGCACAAAGTGGAAGTGTTACTACATGGCAAGTACACGTTACCACATGTTTATGCAGTAACACTATTCATAAATTGCAGTAAGACACATTGTTACTA[C/T]
AAAACTTATGGTTTTTACTACACACTTACAGTAACGTCACGATGGGATTGTAGTAACGCATAACAGATAGTACTAACAAGTAGTAATGCTATAGTATTAC

Reverse complement sequence

GTAATACTATAGCATTACTACTTGTTAGTACTATCTGTTATGCGTTACTACAATCCCATCGTGACGTTACTGTAAGTGTGTAGTAAAAACCATAAGTTTT[G/A]
TAGTAACAATGTGTCTTACTGCAATTTATGAATAGTGTTACTGCATAAACATGTGGTAACGTGTACTTGCCATGTAGTAACACTTCCACTTTGTGCTGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 25.70% 2.37% 3.72% NA
All Indica  2759 77.00% 20.00% 2.03% 0.98% NA
All Japonica  1512 63.80% 25.50% 2.18% 8.47% NA
Aus  269 11.20% 81.40% 4.46% 2.97% NA
Indica I  595 69.40% 27.70% 2.69% 0.17% NA
Indica II  465 69.00% 25.20% 3.66% 2.15% NA
Indica III  913 83.10% 14.90% 0.77% 1.20% NA
Indica Intermediate  786 80.30% 17.00% 2.04% 0.64% NA
Temperate Japonica  767 91.70% 7.60% 0.13% 0.65% NA
Tropical Japonica  504 28.00% 45.40% 5.95% 20.63% NA
Japonica Intermediate  241 50.20% 41.10% 0.83% 7.88% NA
VI/Aromatic  96 55.20% 27.10% 8.33% 9.38% NA
Intermediate  90 58.90% 33.30% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003607263 C -> T LOC_Os10g06930.1 upstream_gene_variant ; 4998.0bp to feature; MODIFIER silent_mutation Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N
vg1003607263 C -> T LOC_Os10g06920-LOC_Os10g06930 intergenic_region ; MODIFIER silent_mutation Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N
vg1003607263 C -> DEL N N silent_mutation Average:16.018; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003607263 NA 2.72E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263 NA 1.10E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263 NA 7.27E-08 mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003607263 NA 9.01E-06 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251