Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003606152:

Variant ID: vg1003606152 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3606152
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CACCCCTCCCCTTTTTTTGAGAGAGAAAAAAAAGGAAAAATTTGCCTTCAATGGGAATAGAACTCAAGACCTTCAACTCAAATTACCACATGGCACTAAC[C/T]
AGTAGGCTATTTCTCAGTTGTGAGAAAGTTTTCTTAGTAAAAATTTATCTTCTCATACGTGCTAAATCCTTGTAGTAACGATACGCGTCCGGTTACTACA

Reverse complement sequence

TGTAGTAACCGGACGCGTATCGTTACTACAAGGATTTAGCACGTATGAGAAGATAAATTTTTACTAAGAAAACTTTCTCACAACTGAGAAATAGCCTACT[G/A]
GTTAGTGCCATGTGGTAATTTGAGTTGAAGGTCTTGAGTTCTATTCCCATTGAAGGCAAATTTTTCCTTTTTTTTCTCTCTCAAAAAAAGGGGAGGGGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	24.20%	4.19%	18.41%	NA
All Indica	2759	29.30%	32.70%	6.74%	31.21%	NA
All Japonica	1512	88.90%	10.90%	0.07%	0.13%	NA
Aus	269	89.20%	8.60%	2.23%	0.00%	NA
Indica I	595	35.30%	32.60%	3.03%	29.08%	NA
Indica II	465	32.70%	31.20%	6.02%	30.11%	NA
Indica III	913	26.60%	26.70%	11.61%	35.05%	NA
Indica Intermediate	786	26.00%	40.70%	4.33%	29.01%	NA
Temperate Japonica	767	94.90%	4.80%	0.13%	0.13%	NA
Tropical Japonica	504	79.20%	20.80%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	9.50%	0.00%	0.41%	NA
VI/Aromatic	96	65.60%	34.40%	0.00%	0.00%	NA
Intermediate	90	62.20%	24.40%	5.56%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003606152	C -> T	LOC_Os10g06920.1	downstream_gene_variant ; 3938.0bp to feature; MODIFIER	silent_mutation	Average:10.991; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1003606152	C -> T	LOC_Os10g06920-LOC_Os10g06930	intergenic_region ; MODIFIER	silent_mutation	Average:10.991; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg1003606152	C -> DEL	N	N	silent_mutation	Average:10.991; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003606152	4.63E-06	NA	mr1183	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	5.53E-06	NA	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	1.41E-07	5.98E-15	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	NA	7.50E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	NA	7.09E-07	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	2.60E-10	1.11E-18	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003606152	1.63E-08	3.72E-16	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251