\
| Variant ID: vg1003599620 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3599620 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 241. )
AACACAATATAATCCCATTGCAATTGATTCGTCTAAATTCCATCCCTTTCAAATCATCTGCGTTAACTAACCAACCAGCCGAAACCCATTCTGATTCGAA[C/T]
TTATTGCAGTACCTCCTCAACGTTGACTATATCAAACACGGTGGGCAGACAACAGAATTCTCGGGCGAGGCCCTGTCCAACACTCTTCGCGATTGGTTCA
TGAACCAATCGCGAAGAGTGTTGGACAGGGCCTCGCCCGAGAATTCTGTTGTCTGCCCACCGTGTTTGATATAGTCAACGTTGAGGAGGTACTGCAATAA[G/A]
TTCGAATCAGAATGGGTTTCGGCTGGTTGGTTAGTTAACGCAGATGATTTGAAAGGGATGGAATTTAGACGAATCAATTGCAATGGGATTATATTGTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.60% | 24.40% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 67.00% | 32.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 89.10% | 10.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.70% | 32.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.10% | 26.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 58.70% | 41.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.90% | 9.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003599620 | C -> T | LOC_Os10g06920.1 | upstream_gene_variant ; 2142.0bp to feature; MODIFIER | silent_mutation | Average:38.46; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| vg1003599620 | C -> T | LOC_Os10g06910.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.46; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003599620 | NA | 4.81E-06 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | 3.91E-08 | 7.93E-16 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | 3.21E-06 | 9.80E-11 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | NA | 7.60E-06 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | NA | 5.10E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | NA | 1.48E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | NA | 7.59E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | NA | 2.76E-06 | mr1558_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | 7.16E-15 | 1.20E-21 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003599620 | 2.89E-12 | 2.55E-19 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |