| Variant ID: vg1003557200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3557200 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCATGGGCGGATGTGAGGTGATTCCTAGCGTAGTTTTGTTTGACTACTGCCTTGTGAAATTTGCTGTTGTGGAATGGGTTTGATATTTGGAAAATCTGC[A/T,G]
GCTGATGGGATCAGCCAGGCCCGGGTGGCCGTTTGAAAGCTGTTGGCCGGGTGCCAATCTTGATCAATTCAAAAGACTGAAACATTGCACATACTCCGAC
GTCGGAGTATGTGCAATGTTTCAGTCTTTTGAATTGATCAAGATTGGCACCCGGCCAACAGCTTTCAAACGGCCACCCGGGCCTGGCTGATCCCATCAGC[T/A,C]
GCAGATTTTCCAAATATCAAACCCATTCCACAACAGCAAATTTCACAAGGCAGTAGTCAAACAAAACTACGCTAGGAATCACCTCACATCCGCCCATGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.10% | 0.10% | 31.49% | 44.22% | G: 0.04% |
| All Indica | 2759 | 4.60% | 0.20% | 39.25% | 55.96% | NA |
| All Japonica | 1512 | 59.90% | 0.00% | 17.66% | 22.35% | G: 0.13% |
| Aus | 269 | 9.30% | 0.00% | 36.06% | 54.65% | NA |
| Indica I | 595 | 4.00% | 0.00% | 18.82% | 77.14% | NA |
| Indica II | 465 | 1.90% | 0.20% | 42.37% | 55.48% | NA |
| Indica III | 913 | 6.90% | 0.20% | 53.01% | 39.87% | NA |
| Indica Intermediate | 786 | 3.80% | 0.40% | 36.90% | 58.91% | NA |
| Temperate Japonica | 767 | 88.50% | 0.00% | 3.91% | 7.56% | NA |
| Tropical Japonica | 504 | 25.00% | 0.00% | 36.51% | 38.49% | NA |
| Japonica Intermediate | 241 | 41.50% | 0.00% | 21.99% | 35.68% | G: 0.83% |
| VI/Aromatic | 96 | 58.30% | 0.00% | 15.62% | 26.04% | NA |
| Intermediate | 90 | 31.10% | 0.00% | 28.89% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003557200 | A -> G | LOC_Os10g06820.1 | upstream_gene_variant ; 801.0bp to feature; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> G | LOC_Os10g06810.1 | downstream_gene_variant ; 3589.0bp to feature; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> G | LOC_Os10g06810-LOC_Os10g06820 | intergenic_region ; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> T | LOC_Os10g06820.1 | upstream_gene_variant ; 801.0bp to feature; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> T | LOC_Os10g06810.1 | downstream_gene_variant ; 3589.0bp to feature; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> T | LOC_Os10g06810-LOC_Os10g06820 | intergenic_region ; MODIFIER | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| vg1003557200 | A -> DEL | N | N | silent_mutation | Average:13.166; most accessible tissue: Minghui63 young leaf, score: 21.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003557200 | 1.29E-06 | 3.14E-06 | mr1040_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 2.55E-06 | NA | mr1217_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 4.04E-06 | 6.49E-07 | mr1295_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 1.69E-06 | NA | mr1304_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 8.46E-07 | NA | mr1381_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 1.70E-06 | NA | mr1595_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 5.05E-06 | NA | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 2.26E-06 | NA | mr1874_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003557200 | 4.47E-06 | 3.96E-06 | mr1951_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |