\
| Variant ID: vg1003521569 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3521569 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGACTTGCCGGTCAGACCGGCCACACACCGCCGGTCTGGCCGGCCCTCCACCGGTGGTCTGACCGGCCAACACATGGCAGTCAGACCGGCCCACTCGGAG[G/A]
AAACTGGCAGACTTCCAAACTTTGGCAATTTTTCCTATTTTTATCCTAAGTGCCAAATTTATGTGTAAATAAATTCTACTGCATTATTCCATTTGTACAA
TTGTACAAATGGAATAATGCAGTAGAATTTATTTACACATAAATTTGGCACTTAGGATAAAAATAGGAAAAATTGCCAAAGTTTGGAAGTCTGCCAGTTT[C/T]
CTCCGAGTGGGCCGGTCTGACTGCCATGTGTTGGCCGGTCAGACCACCGGTGGAGGGCCGGCCAGACCGGCGGTGTGTGGCCGGTCTGACCGGCAAGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.40% | 20.40% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 65.20% | 34.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.20% | 38.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 75.30% | 24.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 57.40% | 42.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 71.50% | 28.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003521569 | G -> A | LOC_Os10g06760.1 | downstream_gene_variant ; 2921.0bp to feature; MODIFIER | silent_mutation | Average:54.199; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1003521569 | G -> A | LOC_Os10g06770.1 | downstream_gene_variant ; 4222.0bp to feature; MODIFIER | silent_mutation | Average:54.199; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1003521569 | G -> A | LOC_Os10g06760-LOC_Os10g06770 | intergenic_region ; MODIFIER | silent_mutation | Average:54.199; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003521569 | 6.23E-12 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 2.55E-12 | 1.00E-13 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 5.43E-18 | 1.02E-21 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 1.33E-15 | 1.64E-20 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 2.40E-56 | 5.27E-61 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 5.21E-51 | 2.83E-74 | mr1709 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | NA | 4.17E-07 | mr1251_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | NA | 6.24E-06 | mr1291_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | NA | 5.07E-07 | mr1435_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 1.19E-11 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 3.57E-14 | 1.69E-18 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 7.52E-19 | 7.42E-24 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 4.57E-19 | 4.00E-26 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 7.50E-75 | 1.87E-98 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521569 | 1.51E-58 | 1.50E-103 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |