Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003521296:

Variant ID: vg1003521296 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3521296
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GAGATGTCGCACTCTCGCAGCGGCGGCGGACGATTTACGGCGCAAATCGACAAAGATGGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAACGATTC[G/A]
ATTGATTGATTTTAGATTGATTAGTTACAATTGAACTGGCCATGTCCCTTATATAGAGGTTGGTCTTACCCTTTACAAGCCCTCCTCCATGTCTAAGAAA

Reverse complement sequence

TTTCTTAGACATGGAGGAGGGCTTGTAAAGGGTAAGACCAACCTCTATATAAGGGACATGGCCAGTTCAATTGTAACTAATCAATCTAAAATCAATCAAT[C/T]
GAATCGTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCCATCTTTGTCGATTTGCGCCGTAAATCGTCCGCCGCCGCTGCGAGAGTGCGACATCTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	42.70%	0.23%	0.00%	NA
All Indica	2759	51.30%	48.40%	0.40%	0.00%	NA
All Japonica	1512	63.80%	36.20%	0.00%	0.00%	NA
Aus	269	87.70%	12.30%	0.00%	0.00%	NA
Indica I	595	49.70%	50.30%	0.00%	0.00%	NA
Indica II	465	56.80%	42.60%	0.65%	0.00%	NA
Indica III	913	55.50%	43.90%	0.55%	0.00%	NA
Indica Intermediate	786	44.10%	55.50%	0.38%	0.00%	NA
Temperate Japonica	767	91.90%	8.10%	0.00%	0.00%	NA
Tropical Japonica	504	27.40%	72.60%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	49.40%	0.00%	0.00%	NA
VI/Aromatic	96	36.50%	63.50%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003521296	G -> A	LOC_Os10g06760.1	downstream_gene_variant ; 2648.0bp to feature; MODIFIER	silent_mutation	Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877	N	N	N	N
vg1003521296	G -> A	LOC_Os10g06770.1	downstream_gene_variant ; 4495.0bp to feature; MODIFIER	silent_mutation	Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877	N	N	N	N
vg1003521296	G -> A	LOC_Os10g06760-LOC_Os10g06770	intergenic_region ; MODIFIER	silent_mutation	Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003521296	NA	2.30E-06	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	1.26E-07	2.73E-10	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	1.13E-07	4.12E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	3.48E-13	1.01E-16	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	4.51E-15	1.31E-19	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	6.66E-25	1.54E-33	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	NA	8.90E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	3.55E-11	3.68E-15	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	5.26E-09	1.32E-11	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	6.62E-18	1.59E-26	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	2.23E-20	1.81E-24	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296	6.29E-30	1.06E-48	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251