\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003521296:

Variant ID: vg1003521296 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3521296
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


GAGATGTCGCACTCTCGCAGCGGCGGCGGACGATTTACGGCGCAAATCGACAAAGATGGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAACGATTC[G/A]
ATTGATTGATTTTAGATTGATTAGTTACAATTGAACTGGCCATGTCCCTTATATAGAGGTTGGTCTTACCCTTTACAAGCCCTCCTCCATGTCTAAGAAA

Reverse complement sequence

TTTCTTAGACATGGAGGAGGGCTTGTAAAGGGTAAGACCAACCTCTATATAAGGGACATGGCCAGTTCAATTGTAACTAATCAATCTAAAATCAATCAAT[C/T]
GAATCGTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCCATCTTTGTCGATTTGCGCCGTAAATCGTCCGCCGCCGCTGCGAGAGTGCGACATCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 42.70% 0.23% 0.00% NA
All Indica  2759 51.30% 48.40% 0.40% 0.00% NA
All Japonica  1512 63.80% 36.20% 0.00% 0.00% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 49.70% 50.30% 0.00% 0.00% NA
Indica II  465 56.80% 42.60% 0.65% 0.00% NA
Indica III  913 55.50% 43.90% 0.55% 0.00% NA
Indica Intermediate  786 44.10% 55.50% 0.38% 0.00% NA
Temperate Japonica  767 91.90% 8.10% 0.00% 0.00% NA
Tropical Japonica  504 27.40% 72.60% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 36.50% 63.50% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003521296 G -> A LOC_Os10g06760.1 downstream_gene_variant ; 2648.0bp to feature; MODIFIER silent_mutation Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 N N N N
vg1003521296 G -> A LOC_Os10g06770.1 downstream_gene_variant ; 4495.0bp to feature; MODIFIER silent_mutation Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 N N N N
vg1003521296 G -> A LOC_Os10g06760-LOC_Os10g06770 intergenic_region ; MODIFIER silent_mutation Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003521296 NA 2.30E-06 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 1.26E-07 2.73E-10 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 1.13E-07 4.12E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 3.48E-13 1.01E-16 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 4.51E-15 1.31E-19 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 6.66E-25 1.54E-33 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 NA 8.90E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 3.55E-11 3.68E-15 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 5.26E-09 1.32E-11 mr1547_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 6.62E-18 1.59E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 2.23E-20 1.81E-24 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003521296 6.29E-30 1.06E-48 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251