\
| Variant ID: vg1003521296 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3521296 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 120. )
GAGATGTCGCACTCTCGCAGCGGCGGCGGACGATTTACGGCGCAAATCGACAAAGATGGACAAACTAAGAGAAAACTAAAAGCAATATGAAAAACGATTC[G/A]
ATTGATTGATTTTAGATTGATTAGTTACAATTGAACTGGCCATGTCCCTTATATAGAGGTTGGTCTTACCCTTTACAAGCCCTCCTCCATGTCTAAGAAA
TTTCTTAGACATGGAGGAGGGCTTGTAAAGGGTAAGACCAACCTCTATATAAGGGACATGGCCAGTTCAATTGTAACTAATCAATCTAAAATCAATCAAT[C/T]
GAATCGTTTTTCATATTGCTTTTAGTTTTCTCTTAGTTTGTCCATCTTTGTCGATTTGCGCCGTAAATCGTCCGCCGCCGCTGCGAGAGTGCGACATCTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.10% | 42.70% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 51.30% | 48.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 63.80% | 36.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 49.70% | 50.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 56.80% | 42.60% | 0.65% | 0.00% | NA |
| Indica III | 913 | 55.50% | 43.90% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 44.10% | 55.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 27.40% | 72.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003521296 | G -> A | LOC_Os10g06760.1 | downstream_gene_variant ; 2648.0bp to feature; MODIFIER | silent_mutation | Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| vg1003521296 | G -> A | LOC_Os10g06770.1 | downstream_gene_variant ; 4495.0bp to feature; MODIFIER | silent_mutation | Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| vg1003521296 | G -> A | LOC_Os10g06760-LOC_Os10g06770 | intergenic_region ; MODIFIER | silent_mutation | Average:54.662; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003521296 | NA | 2.30E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 1.26E-07 | 2.73E-10 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 1.13E-07 | 4.12E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 3.48E-13 | 1.01E-16 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 4.51E-15 | 1.31E-19 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 6.66E-25 | 1.54E-33 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | NA | 8.90E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 3.55E-11 | 3.68E-15 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 5.26E-09 | 1.32E-11 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 6.62E-18 | 1.59E-26 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 2.23E-20 | 1.81E-24 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003521296 | 6.29E-30 | 1.06E-48 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |