\
| Variant ID: vg1003520346 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3520346 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )
AAATCCTGGAGAGATTAACGAAATCACCATAGGCGCCTCGCTGTCGACGGGTATGTCGCCTACCACTGAAAGCACAACACCGTTAAATCTTAGAAAATTC[G/A]
CTCCCATGGGAAGTCGAACCCAGCACCTCATATCTAAATTCTTCTTGGAATAAAACCCATCAATGAACAATTTTTCTTTAGCACTAACATCACCGGACTG
CAGTCCGGTGATGTTAGTGCTAAAGAAAAATTGTTCATTGATGGGTTTTATTCCAAGAAGAATTTAGATATGAGGTGCTGGGTTCGACTTCCCATGGGAG[C/T]
GAATTTTCTAAGATTTAACGGTGTTGTGCTTTCAGTGGTAGGCGACATACCCGTCGACAGCGAGGCGCCTATGGTGATTTCGTTAATCTCTCCAGGATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.80% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 49.70% | 50.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 63.70% | 36.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 47.70% | 52.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 56.30% | 43.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 53.00% | 46.50% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 43.50% | 56.20% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 27.40% | 72.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 49.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003520346 | G -> A | LOC_Os10g06760.1 | downstream_gene_variant ; 1698.0bp to feature; MODIFIER | silent_mutation | Average:71.434; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| vg1003520346 | G -> A | LOC_Os10g06760-LOC_Os10g06770 | intergenic_region ; MODIFIER | silent_mutation | Average:71.434; most accessible tissue: Zhenshan97 flower, score: 80.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003520346 | NA | 2.30E-06 | mr1121 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 2.47E-08 | 6.33E-11 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 1.02E-07 | 3.22E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 1.20E-13 | 2.71E-17 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 4.56E-16 | 1.72E-20 | mr1709 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 7.94E-26 | 9.80E-34 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | NA | 8.90E-06 | mr1043_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 2.12E-10 | 9.28E-15 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 3.00E-08 | 5.94E-11 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 7.23E-17 | 1.69E-25 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 2.20E-23 | 4.93E-25 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003520346 | 7.35E-37 | 2.17E-50 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |