\
| Variant ID: vg1003510976 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3510976 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 182. )
GCAGCTTCTCATTGTAGGTTACATTTGTGTGTCCTTGGCATGGCAGATTTGTGCTAGTATATTTGTGGAATTGTTTGGCTGCTATAATTATAATTTTTGG[T/C]
GGTTTCATTTTAAGTTGGTTTTGGAGAGGCTGTGTATAGAGATTTACTGGGTTCGTCTGGAAAGGTTTTAGTAGGTTGGAGAATCAGAGGAATATTTACT
AGTAAATATTCCTCTGATTCTCCAACCTACTAAAACCTTTCCAGACGAACCCAGTAAATCTCTATACACAGCCTCTCCAAAACCAACTTAAAATGAAACC[A/G]
CCAAAAATTATAATTATAGCAGCCAAACAATTCCACAAATATACTAGCACAAATCTGCCATGCCAAGGACACACAAATGTAACCTACAATGAGAAGCTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.80% | 39.70% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 57.60% | 41.90% | 0.43% | 0.00% | NA |
| All Japonica | 1512 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.90% | 36.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 39.60% | 60.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 71.50% | 27.60% | 0.88% | 0.00% | NA |
| Indica Intermediate | 786 | 47.50% | 52.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 62.10% | 37.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 25.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 45.80% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 46.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003510976 | T -> C | LOC_Os10g06760.1 | upstream_gene_variant ; 3928.0bp to feature; MODIFIER | silent_mutation | Average:38.583; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| vg1003510976 | T -> C | LOC_Os10g06740-LOC_Os10g06760 | intergenic_region ; MODIFIER | silent_mutation | Average:38.583; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003510976 | NA | 4.79E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 9.41E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 1.81E-06 | 2.46E-07 | mr1547 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 9.66E-07 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 8.82E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 5.90E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 1.19E-11 | 1.04E-23 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 1.76E-10 | 1.18E-19 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 5.95E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 9.28E-06 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 3.66E-22 | 4.32E-49 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 1.39E-15 | 1.27E-29 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | 1.29E-09 | 2.04E-16 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003510976 | NA | 4.80E-06 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |