Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003510976:

Variant ID: vg1003510976 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3510976
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

GCAGCTTCTCATTGTAGGTTACATTTGTGTGTCCTTGGCATGGCAGATTTGTGCTAGTATATTTGTGGAATTGTTTGGCTGCTATAATTATAATTTTTGG[T/C]
GGTTTCATTTTAAGTTGGTTTTGGAGAGGCTGTGTATAGAGATTTACTGGGTTCGTCTGGAAAGGTTTTAGTAGGTTGGAGAATCAGAGGAATATTTACT

Reverse complement sequence

AGTAAATATTCCTCTGATTCTCCAACCTACTAAAACCTTTCCAGACGAACCCAGTAAATCTCTATACACAGCCTCTCCAAAACCAACTTAAAATGAAACC[A/G]
CCAAAAATTATAATTATAGCAGCCAAACAATTCCACAAATATACTAGCACAAATCTGCCATGCCAAGGACACACAAATGTAACCTACAATGAGAAGCTGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	39.70%	0.57%	0.00%	NA
All Indica	2759	57.60%	41.90%	0.43%	0.00%	NA
All Japonica	1512	74.80%	25.20%	0.00%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	63.90%	36.00%	0.17%	0.00%	NA
Indica II	465	39.60%	60.00%	0.43%	0.00%	NA
Indica III	913	71.50%	27.60%	0.88%	0.00%	NA
Indica Intermediate	786	47.50%	52.40%	0.13%	0.00%	NA
Temperate Japonica	767	62.10%	37.90%	0.00%	0.00%	NA
Tropical Japonica	504	94.20%	5.80%	0.00%	0.00%	NA
Japonica Intermediate	241	74.70%	25.30%	0.00%	0.00%	NA
VI/Aromatic	96	41.70%	45.80%	12.50%	0.00%	NA
Intermediate	90	50.00%	46.70%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003510976	T -> C	LOC_Os10g06760.1	upstream_gene_variant ; 3928.0bp to feature; MODIFIER	silent_mutation	Average:38.583; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N
vg1003510976	T -> C	LOC_Os10g06740-LOC_Os10g06760	intergenic_region ; MODIFIER	silent_mutation	Average:38.583; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003510976	NA	4.79E-06	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	9.41E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	1.81E-06	2.46E-07	mr1547	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	9.66E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	8.82E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	5.90E-06	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	1.19E-11	1.04E-23	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	1.76E-10	1.18E-19	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	5.95E-08	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	9.28E-06	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	3.66E-22	4.32E-49	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	1.39E-15	1.27E-29	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	1.29E-09	2.04E-16	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003510976	NA	4.80E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251