Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003496760:

Variant ID: vg1003496760 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3496760
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGCTCGGAATATGTATGGATGTGGCATCAACTCTGTTTCCAATCATGTGGCCGTTTTGGTTGCACCGGCAATGAATGCAACTAGTCCATGCATACCTC[T/C]
ATGGAATTGTGAATGATGGACAGTGGAGAAGATAGATAGATTCCCAGGAAATGGAAACAATAGAACAAATGCACATGGTGAGCATAGGGATTGCTCCTTT

Reverse complement sequence

AAAGGAGCAATCCCTATGCTCACCATGTGCATTTGTTCTATTGTTTCCATTTCCTGGGAATCTATCTATCTTCTCCACTGTCCATCATTCACAATTCCAT[A/G]
GAGGTATGCATGGACTAGTTGCATTCATTGCCGGTGCAACCAAAACGGCCACATGATTGGAAACAGAGTTGATGCCACATCCATACATATTCCGAGCACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 45.50% 0.23% 0.28% NA
All Indica  2759 59.10% 40.20% 0.25% 0.43% NA
All Japonica  1512 35.50% 64.40% 0.13% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 55.60% 44.00% 0.17% 0.17% NA
Indica II  465 73.30% 25.20% 0.65% 0.86% NA
Indica III  913 46.80% 52.50% 0.22% 0.55% NA
Indica Intermediate  786 67.70% 31.90% 0.13% 0.25% NA
Temperate Japonica  767 42.80% 57.00% 0.26% 0.00% NA
Tropical Japonica  504 25.20% 74.80% 0.00% 0.00% NA
Japonica Intermediate  241 34.00% 66.00% 0.00% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003496760 T -> C LOC_Os10g06740.1 upstream_gene_variant ; 3805.0bp to feature; MODIFIER silent_mutation Average:88.617; most accessible tissue: Callus, score: 99.217 N N N N
vg1003496760 T -> C LOC_Os10g06730-LOC_Os10g06740 intergenic_region ; MODIFIER silent_mutation Average:88.617; most accessible tissue: Callus, score: 99.217 N N N N
vg1003496760 T -> DEL N N silent_mutation Average:88.617; most accessible tissue: Callus, score: 99.217 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003496760 T C -0.06 -0.03 -0.01 0.0 -0.09 -0.17

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003496760 2.18E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 9.89E-12 4.62E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 7.88E-18 1.07E-18 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 2.37E-17 1.52E-22 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 3.07E-42 7.10E-69 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 8.21E-45 1.93E-69 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 NA 7.13E-10 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 NA 4.36E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 NA 2.14E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 NA 2.59E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 8.04E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 2.12E-12 1.70E-16 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 3.15E-18 1.55E-26 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 1.69E-19 2.26E-26 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 1.46E-72 8.12E-126 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 9.13E-69 3.62E-114 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003496760 7.54E-14 7.11E-31 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251