Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003484913:

Variant ID: vg1003484913 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3484913
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

ATGGATATAATGCTCGGGTAGATTAAATTGAAAACTTATGACAACAAAATATTTATACCCGCAAAATAGTTTGAATCGAAATTGGGTTTGCCTTAGTTCG[T/C]
GAATAATAAAGTTAATATAAAGAAATCGACTTTCGCATTCGACTTTCATTTGGATTTATTTGGATTTTTATTTGAATTCTAACCGAATTCAAATCAATTT

Reverse complement sequence

AAATTGATTTGAATTCGGTTAGAATTCAAATAAAAATCCAAATAAATCCAAATGAAAGTCGAATGCGAAAGTCGATTTCTTTATATTAACTTTATTATTC[A/G]
CGAACTAAGGCAAACCCAATTTCGATTCAAACTATTTTGCGGGTATAAATATTTTGTTGTCATAAGTTTTCAATTTAATCTACCCGAGCATTATATCCAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.00%	18.80%	3.20%	0.00%	NA
All Indica	2759	83.90%	15.30%	0.80%	0.00%	NA
All Japonica	1512	66.80%	30.20%	2.98%	0.00%	NA
Aus	269	90.30%	0.00%	9.67%	0.00%	NA
Indica I	595	80.00%	19.80%	0.17%	0.00%	NA
Indica II	465	87.30%	12.70%	0.00%	0.00%	NA
Indica III	913	83.50%	14.80%	1.75%	0.00%	NA
Indica Intermediate	786	85.50%	13.90%	0.64%	0.00%	NA
Temperate Japonica	767	58.10%	37.40%	4.43%	0.00%	NA
Tropical Japonica	504	79.20%	20.00%	0.79%	0.00%	NA
Japonica Intermediate	241	68.50%	28.60%	2.90%	0.00%	NA
VI/Aromatic	96	45.80%	2.10%	52.08%	0.00%	NA
Intermediate	90	82.20%	8.90%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003484913	T -> C	LOC_Os10g06730.1	upstream_gene_variant ; 663.0bp to feature; MODIFIER	silent_mutation	Average:16.325; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N
vg1003484913	T -> C	LOC_Os10g06730-LOC_Os10g06740	intergenic_region ; MODIFIER	silent_mutation	Average:16.325; most accessible tissue: Zhenshan97 flag leaf, score: 21.748	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003484913	1.67E-06	1.14E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	2.14E-06	5.04E-07	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	6.39E-10	5.79E-13	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	1.49E-07	3.20E-08	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	NA	1.50E-08	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	NA	5.68E-07	mr1831	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	NA	4.03E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	6.38E-08	8.62E-12	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	6.83E-07	1.17E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	3.27E-06	3.27E-06	mr1547_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	1.04E-12	1.06E-16	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	9.76E-09	8.76E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	5.18E-09	1.59E-26	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	NA	9.65E-06	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003484913	NA	1.67E-06	mr1922_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251