Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003478386:

Variant ID: vg1003478386 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3478386
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGTTATCCACGCGCGGCAGGACTACTTCAGAGCATGTACAATAATCAGCTATAAACATATTTTAATATTTTAATAAGATAAATGATAAGAGAGAAGAG[T/C]
AACGGTCTACAGATTTGTAGCCAGCTACAGCACTAACTTCAAGACACACTGTGTATATAACATATAGGACCATATATTAATAGTATAGTAAGCAACTATT

Reverse complement sequence

AATAGTTGCTTACTATACTATTAATATATGGTCCTATATGTTATATACACAGTGTGTCTTGAAGTTAGTGCTGTAGCTGGCTACAAATCTGTAGACCGTT[A/G]
CTCTTCTCTCTTATCATTTATCTTATTAAAATATTAAAATATGTTTATAGCTGATTATTGTACATGCTCTGAAGTAGTCCTGCCGCGCGTGGATAACTCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	22.80%	1.78%	20.72%	NA
All Indica	2759	46.00%	17.30%	1.78%	34.94%	NA
All Japonica	1512	65.90%	33.10%	0.73%	0.26%	NA
Aus	269	88.10%	8.60%	3.35%	0.00%	NA
Indica I	595	36.30%	20.80%	1.68%	41.18%	NA
Indica II	465	62.40%	13.80%	0.22%	23.66%	NA
Indica III	913	35.70%	18.50%	3.18%	42.61%	NA
Indica Intermediate	786	55.50%	15.40%	1.15%	27.99%	NA
Temperate Japonica	767	57.20%	42.10%	0.39%	0.26%	NA
Tropical Japonica	504	78.60%	21.20%	0.00%	0.20%	NA
Japonica Intermediate	241	66.80%	29.50%	3.32%	0.41%	NA
VI/Aromatic	96	28.10%	58.30%	13.54%	0.00%	NA
Intermediate	90	62.20%	23.30%	2.22%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003478386	T -> C	LOC_Os10g06720.1	upstream_gene_variant ; 189.0bp to feature; MODIFIER	silent_mutation	Average:91.907; most accessible tissue: Zhenshan97 root, score: 97.82	N	N	N	N
vg1003478386	T -> C	LOC_Os10g06720.2	upstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:91.907; most accessible tissue: Zhenshan97 root, score: 97.82	N	N	N	N
vg1003478386	T -> C	LOC_Os10g06710.1	downstream_gene_variant ; 3199.0bp to feature; MODIFIER	silent_mutation	Average:91.907; most accessible tissue: Zhenshan97 root, score: 97.82	N	N	N	N
vg1003478386	T -> C	LOC_Os10g06720-LOC_Os10g06730	intergenic_region ; MODIFIER	silent_mutation	Average:91.907; most accessible tissue: Zhenshan97 root, score: 97.82	N	N	N	N
vg1003478386	T -> DEL	N	N	silent_mutation	Average:91.907; most accessible tissue: Zhenshan97 root, score: 97.82	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1003478386	T	C	0.0	0.0	-0.01	-0.03	-0.03	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003478386	NA	9.08E-06	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	8.13E-08	6.51E-08	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	6.60E-07	8.03E-08	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	2.42E-14	5.44E-16	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	4.48E-10	2.42E-10	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	NA	5.35E-10	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	NA	3.01E-07	mr1831	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	4.00E-09	6.28E-13	mr1547_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	5.30E-08	8.00E-10	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	5.24E-06	5.24E-06	mr1547_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	1.50E-21	1.66E-19	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	1.30E-12	3.58E-11	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	9.20E-15	7.59E-34	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003478386	NA	8.68E-06	mr1922_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251