Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003470179:

Variant ID: vg1003470179 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3470179
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTATGAAGTATTGACAGAATTTGTGCAAAAGATCCCCTGCTTCCGTAGTATTGTTTAATTTTGCGCTTTATTTGGTTGGTGCTTTACAGAAGAGTTGA[G/A]
ACCTTCCTTGTTTTAAACTTAGTAACTCCAATGTTTTATTATCTTGAAAGCAATTATGCCTATGTTGTGTACTGATCATTTTAATGATAAAGAGGAAATA

Reverse complement sequence

TATTTCCTCTTTATCATTAAAATGATCAGTACACAACATAGGCATAATTGCTTTCAAGATAATAAAACATTGGAGTTACTAAGTTTAAAACAAGGAAGGT[C/T]
TCAACTCTTCTGTAAAGCACCAACCAAATAAAGCGCAAAATTAAACAATACTACGGAAGCAGGGGATCTTTTGCACAAATTCTGTCAATACTTCATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.20%	41.70%	0.06%	0.00%	NA
All Indica	2759	58.00%	41.90%	0.11%	0.00%	NA
All Japonica	1512	64.40%	35.60%	0.00%	0.00%	NA
Aus	269	16.40%	83.60%	0.00%	0.00%	NA
Indica I	595	62.90%	37.10%	0.00%	0.00%	NA
Indica II	465	38.50%	61.50%	0.00%	0.00%	NA
Indica III	913	74.00%	25.80%	0.11%	0.00%	NA
Indica Intermediate	786	47.20%	52.50%	0.25%	0.00%	NA
Temperate Japonica	767	57.00%	43.00%	0.00%	0.00%	NA
Tropical Japonica	504	74.80%	25.20%	0.00%	0.00%	NA
Japonica Intermediate	241	66.00%	34.00%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003470179	G -> A	LOC_Os10g06710.1	upstream_gene_variant ; 1979.0bp to feature; MODIFIER	silent_mutation	Average:42.507; most accessible tissue: Callus, score: 65.709	N	N	N	N
vg1003470179	G -> A	LOC_Os10g06700.1	downstream_gene_variant ; 859.0bp to feature; MODIFIER	silent_mutation	Average:42.507; most accessible tissue: Callus, score: 65.709	N	N	N	N
vg1003470179	G -> A	LOC_Os10g06700-LOC_Os10g06710	intergenic_region ; MODIFIER	silent_mutation	Average:42.507; most accessible tissue: Callus, score: 65.709	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003470179	NA	3.49E-07	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	2.49E-15	9.32E-28	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	9.33E-12	3.78E-21	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	9.91E-06	9.00E-11	mr1709	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	NA	5.79E-08	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	4.72E-06	4.72E-06	mr1547_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	7.42E-27	1.01E-53	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	9.44E-18	9.25E-31	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179	4.20E-15	7.42E-35	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251