\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003470179:

Variant ID: vg1003470179 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3470179
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATGAAGTATTGACAGAATTTGTGCAAAAGATCCCCTGCTTCCGTAGTATTGTTTAATTTTGCGCTTTATTTGGTTGGTGCTTTACAGAAGAGTTGA[G/A]
ACCTTCCTTGTTTTAAACTTAGTAACTCCAATGTTTTATTATCTTGAAAGCAATTATGCCTATGTTGTGTACTGATCATTTTAATGATAAAGAGGAAATA

Reverse complement sequence

TATTTCCTCTTTATCATTAAAATGATCAGTACACAACATAGGCATAATTGCTTTCAAGATAATAAAACATTGGAGTTACTAAGTTTAAAACAAGGAAGGT[C/T]
TCAACTCTTCTGTAAAGCACCAACCAAATAAAGCGCAAAATTAAACAATACTACGGAAGCAGGGGATCTTTTGCACAAATTCTGTCAATACTTCATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.70% 0.06% 0.00% NA
All Indica  2759 58.00% 41.90% 0.11% 0.00% NA
All Japonica  1512 64.40% 35.60% 0.00% 0.00% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 62.90% 37.10% 0.00% 0.00% NA
Indica II  465 38.50% 61.50% 0.00% 0.00% NA
Indica III  913 74.00% 25.80% 0.11% 0.00% NA
Indica Intermediate  786 47.20% 52.50% 0.25% 0.00% NA
Temperate Japonica  767 57.00% 43.00% 0.00% 0.00% NA
Tropical Japonica  504 74.80% 25.20% 0.00% 0.00% NA
Japonica Intermediate  241 66.00% 34.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 52.20% 47.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003470179 G -> A LOC_Os10g06710.1 upstream_gene_variant ; 1979.0bp to feature; MODIFIER silent_mutation Average:42.507; most accessible tissue: Callus, score: 65.709 N N N N
vg1003470179 G -> A LOC_Os10g06700.1 downstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:42.507; most accessible tissue: Callus, score: 65.709 N N N N
vg1003470179 G -> A LOC_Os10g06700-LOC_Os10g06710 intergenic_region ; MODIFIER silent_mutation Average:42.507; most accessible tissue: Callus, score: 65.709 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003470179 NA 3.49E-07 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 2.49E-15 9.32E-28 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 9.33E-12 3.78E-21 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 9.91E-06 9.00E-11 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 NA 5.79E-08 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 4.72E-06 4.72E-06 mr1547_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 7.42E-27 1.01E-53 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 9.44E-18 9.25E-31 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003470179 4.20E-15 7.42E-35 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251