\
| Variant ID: vg1003470179 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3470179 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 100. )
ATTTATGAAGTATTGACAGAATTTGTGCAAAAGATCCCCTGCTTCCGTAGTATTGTTTAATTTTGCGCTTTATTTGGTTGGTGCTTTACAGAAGAGTTGA[G/A]
ACCTTCCTTGTTTTAAACTTAGTAACTCCAATGTTTTATTATCTTGAAAGCAATTATGCCTATGTTGTGTACTGATCATTTTAATGATAAAGAGGAAATA
TATTTCCTCTTTATCATTAAAATGATCAGTACACAACATAGGCATAATTGCTTTCAAGATAATAAAACATTGGAGTTACTAAGTTTAAAACAAGGAAGGT[C/T]
TCAACTCTTCTGTAAAGCACCAACCAAATAAAGCGCAAAATTAAACAATACTACGGAAGCAGGGGATCTTTTGCACAAATTCTGTCAATACTTCATAAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.20% | 41.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 58.00% | 41.90% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.40% | 83.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 62.90% | 37.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 38.50% | 61.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.00% | 25.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 47.20% | 52.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 57.00% | 43.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 34.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 47.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003470179 | G -> A | LOC_Os10g06710.1 | upstream_gene_variant ; 1979.0bp to feature; MODIFIER | silent_mutation | Average:42.507; most accessible tissue: Callus, score: 65.709 | N | N | N | N |
| vg1003470179 | G -> A | LOC_Os10g06700.1 | downstream_gene_variant ; 859.0bp to feature; MODIFIER | silent_mutation | Average:42.507; most accessible tissue: Callus, score: 65.709 | N | N | N | N |
| vg1003470179 | G -> A | LOC_Os10g06700-LOC_Os10g06710 | intergenic_region ; MODIFIER | silent_mutation | Average:42.507; most accessible tissue: Callus, score: 65.709 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003470179 | NA | 3.49E-07 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 2.49E-15 | 9.32E-28 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 9.33E-12 | 3.78E-21 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 9.91E-06 | 9.00E-11 | mr1709 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | NA | 5.79E-08 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 4.72E-06 | 4.72E-06 | mr1547_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 7.42E-27 | 1.01E-53 | mr1709_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 9.44E-18 | 9.25E-31 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003470179 | 4.20E-15 | 7.42E-35 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |