Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003467337:

Variant ID: vg1003467337 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3467337
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGTCTAGCATTTTTTTTTTCAAATATACCAAATAAAATAATTTCTTACATGATTTGAATAATATAAATCCCCTCTCCTCCTCCCCACATCATATACAA[T/C]
AAGTAAGTAATAGTCTAGAACAATTTTTGCTCTCATTACCAATAGTGCTCACCACCGACTCATTCACTTGTGCATGCAATGGCACTACGGCTACCTCACC

Reverse complement sequence

GGTGAGGTAGCCGTAGTGCCATTGCATGCACAAGTGAATGAGTCGGTGGTGAGCACTATTGGTAATGAGAGCAAAAATTGTTCTAGACTATTACTTACTT[A/G]
TTGTATATGATGTGGGGAGGAGGAGAGGGGATTTATATTATTCAAATCATGTAAGAAATTATTTTATTTGGTATATTTGAAAAAAAAAATGCTAGACCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.30%	0.49%	0.00%	NA
All Indica	2759	95.50%	4.00%	0.51%	0.00%	NA
All Japonica	1512	35.70%	64.00%	0.33%	0.00%	NA
Aus	269	87.40%	12.30%	0.37%	0.00%	NA
Indica I	595	98.80%	0.00%	1.18%	0.00%	NA
Indica II	465	98.90%	0.60%	0.43%	0.00%	NA
Indica III	913	90.50%	9.30%	0.22%	0.00%	NA
Indica Intermediate	786	96.80%	2.80%	0.38%	0.00%	NA
Temperate Japonica	767	42.80%	56.60%	0.65%	0.00%	NA
Tropical Japonica	504	25.40%	74.60%	0.00%	0.00%	NA
Japonica Intermediate	241	34.90%	65.10%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	59.40%	3.12%	0.00%	NA
Intermediate	90	65.60%	34.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003467337	T -> C	LOC_Os10g06690.1	upstream_gene_variant ; 2436.0bp to feature; MODIFIER	silent_mutation	Average:64.994; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg1003467337	T -> C	LOC_Os10g06700.1	upstream_gene_variant ; 669.0bp to feature; MODIFIER	silent_mutation	Average:64.994; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg1003467337	T -> C	LOC_Os10g06710.1	upstream_gene_variant ; 4821.0bp to feature; MODIFIER	silent_mutation	Average:64.994; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg1003467337	T -> C	LOC_Os10g06680.1	downstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:64.994; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg1003467337	T -> C	LOC_Os10g06690-LOC_Os10g06700	intergenic_region ; MODIFIER	silent_mutation	Average:64.994; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003467337	NA	2.78E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	7.49E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	2.54E-06	2.80E-11	mr1709	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	2.94E-07	mr1761	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	5.59E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	6.90E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	9.75E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	5.48E-08	1.86E-09	mr1709_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	2.90E-16	7.17E-36	mr1709_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	2.61E-09	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	4.37E-13	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	NA	5.52E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	9.19E-06	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003467337	9.26E-06	1.68E-11	mr1821_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251