\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003465379:

Variant ID: vg1003465379 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3465379
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGTTTACTGTAGCACTATATTGTCAAATCATGGTTTAATTAAGCTCAAAAGATTCGTCTCGTAATTTACATGTAAACTGTGTAATTATTTTTTTCTC[C/T]
ATATTTAATGCTCCATACATGTGTCCAAACGTTTGATGTAATGAAAAAGTTGAAAGTTTGAAGGAAACTAAACCAAATATCATTGTGAGTTTGGTATTCC

Reverse complement sequence

GGAATACCAAACTCACAATGATATTTGGTTTAGTTTCCTTCAAACTTTCAACTTTTTCATTACATCAAACGTTTGGACACATGTATGGAGCATTAAATAT[G/A]
GAGAAAAAAATAATTACACAGTTTACATGTAAATTACGAGACGAATCTTTTGAGCTTAATTAAACCATGATTTGACAATATAGTGCTACAGTAAACATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 32.60% 1.23% 23.34% NA
All Indica  2759 57.10% 5.10% 1.41% 36.39% NA
All Japonica  1512 12.00% 87.60% 0.07% 0.33% NA
Aus  269 84.80% 3.70% 1.12% 10.41% NA
Indica I  595 55.10% 3.50% 2.02% 39.33% NA
Indica II  465 75.30% 0.90% 0.22% 23.66% NA
Indica III  913 41.10% 9.50% 2.19% 47.21% NA
Indica Intermediate  786 66.50% 3.60% 0.76% 29.13% NA
Temperate Japonica  767 5.10% 94.50% 0.13% 0.26% NA
Tropical Japonica  504 23.40% 76.40% 0.00% 0.20% NA
Japonica Intermediate  241 10.00% 89.20% 0.00% 0.83% NA
VI/Aromatic  96 2.10% 34.40% 13.54% 50.00% NA
Intermediate  90 42.20% 35.60% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003465379 C -> T LOC_Os10g06690.1 upstream_gene_variant ; 478.0bp to feature; MODIFIER silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N
vg1003465379 C -> T LOC_Os10g06700.1 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N
vg1003465379 C -> T LOC_Os10g06670.1 downstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N
vg1003465379 C -> T LOC_Os10g06680.1 downstream_gene_variant ; 1112.0bp to feature; MODIFIER silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N
vg1003465379 C -> T LOC_Os10g06690-LOC_Os10g06700 intergenic_region ; MODIFIER silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N
vg1003465379 C -> DEL N N silent_mutation Average:37.95; most accessible tissue: Zhenshan97 flower, score: 82.718 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003465379 NA 1.47E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 1.65E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 1.60E-11 5.92E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 1.57E-17 1.32E-14 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 6.69E-18 2.08E-24 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 3.18E-45 2.53E-52 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 6.21E-44 3.60E-68 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 NA 2.64E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 NA 3.66E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 NA 1.33E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 3.00E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 5.35E-12 1.22E-17 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 1.28E-18 4.63E-18 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 2.13E-19 1.40E-27 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 3.16E-65 3.04E-75 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003465379 4.81E-61 2.86E-106 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251