\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003446689:

Variant ID: vg1003446689 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3446689
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGTGTTCCGCCATGTCGTCGACGGGATGGACATCGTGCGTGCCGTCGAACGGACCGCCACCTGGAGGGGCAAGATGGTGAAGCCGGTCGTCATCGGCC[T/A]
CTGCGGCAAAGCTCTAGCGCTACTGGTATACGTATGTGCGTATCAGTGTATGTATACACGAAAACGGCCCAGATTAGGGATTTAGATTTGTTTCTCAATT

Reverse complement sequence

AATTGAGAAACAAATCTAAATCCCTAATCTGGGCCGTTTTCGTGTATACATACACTGATACGCACATACGTATACCAGTAGCGCTAGAGCTTTGCCGCAG[A/T]
GGCCGATGACGACCGGCTTCACCATCTTGCCCCTCCAGGTGGCGGTCCGTTCGACGGCACGCACGATGTCCATCCCGTCGACGACATGGCGGAACACGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 23.60% 0.15% 1.74% NA
All Indica  2759 60.80% 38.40% 0.25% 0.58% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 88.10% 3.30% 0.00% 8.55% NA
Indica I  595 55.80% 42.90% 0.67% 0.67% NA
Indica II  465 74.60% 24.10% 0.22% 1.08% NA
Indica III  913 49.80% 49.60% 0.00% 0.55% NA
Indica Intermediate  786 69.10% 30.40% 0.25% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 34.40% 29.20% 0.00% 36.46% NA
Intermediate  90 74.40% 16.70% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003446689 T -> A LOC_Os10g06640.1 missense_variant ; p.Leu60His; MODERATE nonsynonymous_codon ; L60D Average:86.809; most accessible tissue: Minghui63 root, score: 94.153 unknown unknown TOLERATED 0.14
vg1003446689 T -> DEL LOC_Os10g06640.1 N frameshift_variant Average:86.809; most accessible tissue: Minghui63 root, score: 94.153 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1003446689 T A -0.01 0.01 -0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003446689 1.50E-07 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 8.27E-10 4.29E-12 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 4.94E-16 2.16E-21 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 3.44E-15 3.03E-21 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 3.62E-45 7.39E-48 mr1709 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 1.09E-46 2.39E-73 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 9.24E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 4.30E-12 6.04E-18 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 6.25E-15 1.50E-17 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 7.05E-18 1.42E-25 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 2.72E-70 8.25E-83 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003446689 5.74E-69 3.17E-114 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251