\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003436810:

Variant ID: vg1003436810 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3436810
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AATAGATGATATTCGCATATTTTTTTAAATAAGACGAATATGTAATCTATTTTAAAGTCAATCGTGCCAAATATCTATGACCAAAGGGAGTAACATGTAA[G/A]
TATATATACGTATATAGGTCATTTTTAATCTCTACTTAATTAAGAACTGAGACACTTAAAACTATAATATATTTTTTTGTGTATCCATCTTTCATGCAAT

Reverse complement sequence

ATTGCATGAAAGATGGATACACAAAAAAATATATTATAGTTTTAAGTGTCTCAGTTCTTAATTAAGTAGAGATTAAAAATGACCTATATACGTATATATA[C/T]
TTACATGTTACTCCCTTTGGTCATAGATATTTGGCACGATTGACTTTAAAATAGATTACATATTCGTCTTATTTAAAAAAATATGCGAATATCATCTATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.30% 46.30% 0.36% 0.00% NA
All Indica  2759 43.70% 55.70% 0.58% 0.00% NA
All Japonica  1512 74.90% 25.10% 0.00% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 45.50% 54.10% 0.34% 0.00% NA
Indica II  465 26.00% 72.70% 1.29% 0.00% NA
Indica III  913 59.60% 39.90% 0.55% 0.00% NA
Indica Intermediate  786 34.20% 65.40% 0.38% 0.00% NA
Temperate Japonica  767 62.10% 37.90% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003436810 G -> A LOC_Os10g06620.1 upstream_gene_variant ; 2290.0bp to feature; MODIFIER silent_mutation Average:27.838; most accessible tissue: Callus, score: 74.317 N N N N
vg1003436810 G -> A LOC_Os10g06630.1 upstream_gene_variant ; 1662.0bp to feature; MODIFIER silent_mutation Average:27.838; most accessible tissue: Callus, score: 74.317 N N N N
vg1003436810 G -> A LOC_Os10g06610.1 downstream_gene_variant ; 4300.0bp to feature; MODIFIER silent_mutation Average:27.838; most accessible tissue: Callus, score: 74.317 N N N N
vg1003436810 G -> A LOC_Os10g06620-LOC_Os10g06630 intergenic_region ; MODIFIER silent_mutation Average:27.838; most accessible tissue: Callus, score: 74.317 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003436810 NA 3.26E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 2.52E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 9.55E-09 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.26E-12 5.31E-15 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 3.62E-22 6.07E-22 mr1547 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.57E-18 6.40E-25 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 1.84E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 3.66E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 4.69E-32 2.09E-51 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 2.45E-37 3.15E-66 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 3.57E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 8.74E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 NA 1.03E-06 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 2.08E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.90E-12 7.06E-19 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.84E-15 4.16E-20 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 6.18E-19 2.84E-28 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.81E-54 4.62E-105 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 1.16E-48 7.76E-113 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436810 8.06E-09 9.50E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251