\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003436213:

Variant ID: vg1003436213 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3436213
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TGATCAATTCAGTTACTATTATGAATAATTTAGCTTTGCATCATATATTGTTCAATCTAGAACAGAAATATTTCACTGGAAAATGTTTCAAGTCCTCAGT[C/T,G]
ACATGTTTTTTTTTTTTGGCATGTGGTCTGAATAGCTACCAGAAATTCTGTAAAAAGTAGGCCATATAGATTATTGTTTCACGTTCCTCCACAAACATGT

Reverse complement sequence

ACATGTTTGTGGAGGAACGTGAAACAATAATCTATATGGCCTACTTTTTACAGAATTTCTGGTAGCTATTCAGACCACATGCCAAAAAAAAAAAACATGT[G/A,C]
ACTGAGGACTTGAAACATTTTCCAGTGAAATATTTCTGTTCTAGATTGAACAATATATGATGCAAAGCTAAATTATTCATAATAGTAACTGAATTGATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.60% 0.23% 0.00% G: 0.04%
All Indica  2759 43.50% 56.10% 0.33% 0.00% G: 0.07%
All Japonica  1512 74.70% 25.20% 0.07% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 45.70% 54.30% 0.00% 0.00% NA
Indica II  465 26.00% 73.30% 0.65% 0.00% NA
Indica III  913 59.40% 40.30% 0.22% 0.00% G: 0.11%
Indica Intermediate  786 33.80% 65.50% 0.51% 0.00% G: 0.13%
Temperate Japonica  767 61.70% 38.20% 0.13% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003436213 C -> G LOC_Os10g06620.1 upstream_gene_variant ; 1693.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> G LOC_Os10g06630.1 upstream_gene_variant ; 2259.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> G LOC_Os10g06610.1 downstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> G LOC_Os10g06620-LOC_Os10g06630 intergenic_region ; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> T LOC_Os10g06620.1 upstream_gene_variant ; 1693.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> T LOC_Os10g06630.1 upstream_gene_variant ; 2259.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> T LOC_Os10g06610.1 downstream_gene_variant ; 3703.0bp to feature; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N
vg1003436213 C -> T LOC_Os10g06620-LOC_Os10g06630 intergenic_region ; MODIFIER silent_mutation Average:56.457; most accessible tissue: Callus, score: 87.089 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003436213 6.08E-06 6.08E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 7.58E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 1.07E-11 1.63E-13 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 6.66E-20 4.90E-20 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 6.56E-18 4.58E-24 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 7.16E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 5.46E-36 5.39E-53 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 8.10E-43 6.84E-71 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 1.22E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 1.21E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 2.22E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 8.85E-07 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 NA 2.67E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 2.42E-09 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 2.72E-13 1.50E-18 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 6.69E-17 3.60E-20 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 4.73E-21 8.66E-29 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 2.06E-74 1.24E-110 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 1.93E-79 1.75E-133 mr1709_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213 1.42E-10 1.19E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251