Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003436213:

Variant ID: vg1003436213 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3436213
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.20, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TGATCAATTCAGTTACTATTATGAATAATTTAGCTTTGCATCATATATTGTTCAATCTAGAACAGAAATATTTCACTGGAAAATGTTTCAAGTCCTCAGT[C/T,G]
ACATGTTTTTTTTTTTTGGCATGTGGTCTGAATAGCTACCAGAAATTCTGTAAAAAGTAGGCCATATAGATTATTGTTTCACGTTCCTCCACAAACATGT

Reverse complement sequence

ACATGTTTGTGGAGGAACGTGAAACAATAATCTATATGGCCTACTTTTTACAGAATTTCTGGTAGCTATTCAGACCACATGCCAAAAAAAAAAAACATGT[G/A,C]
ACTGAGGACTTGAAACATTTTCCAGTGAAATATTTCTGTTCTAGATTGAACAATATATGATGCAAAGCTAAATTATTCATAATAGTAACTGAATTGATCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.60%	0.23%	0.00%	G: 0.04%
All Indica	2759	43.50%	56.10%	0.33%	0.00%	G: 0.07%
All Japonica	1512	74.70%	25.20%	0.07%	0.00%	NA
Aus	269	15.60%	84.40%	0.00%	0.00%	NA
Indica I	595	45.70%	54.30%	0.00%	0.00%	NA
Indica II	465	26.00%	73.30%	0.65%	0.00%	NA
Indica III	913	59.40%	40.30%	0.22%	0.00%	G: 0.11%
Indica Intermediate	786	33.80%	65.50%	0.51%	0.00%	G: 0.13%
Temperate Japonica	767	61.70%	38.20%	0.13%	0.00%	NA
Tropical Japonica	504	94.40%	5.60%	0.00%	0.00%	NA
Japonica Intermediate	241	75.10%	24.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003436213	C -> G	LOC_Os10g06620.1	upstream_gene_variant ; 1693.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> G	LOC_Os10g06630.1	upstream_gene_variant ; 2259.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> G	LOC_Os10g06610.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> G	LOC_Os10g06620-LOC_Os10g06630	intergenic_region ; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> T	LOC_Os10g06620.1	upstream_gene_variant ; 1693.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> T	LOC_Os10g06630.1	upstream_gene_variant ; 2259.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> T	LOC_Os10g06610.1	downstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N
vg1003436213	C -> T	LOC_Os10g06620-LOC_Os10g06630	intergenic_region ; MODIFIER	silent_mutation	Average:56.457; most accessible tissue: Callus, score: 87.089	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003436213	6.08E-06	6.08E-06	mr1027	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	7.58E-08	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	1.07E-11	1.63E-13	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	6.66E-20	4.90E-20	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	6.56E-18	4.58E-24	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	7.16E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	5.46E-36	5.39E-53	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	8.10E-43	6.84E-71	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	1.22E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	1.21E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	2.22E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	8.85E-07	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	NA	2.67E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	2.42E-09	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	2.72E-13	1.50E-18	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	6.69E-17	3.60E-20	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	4.73E-21	8.66E-29	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	2.06E-74	1.24E-110	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	1.93E-79	1.75E-133	mr1709_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003436213	1.42E-10	1.19E-18	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251