\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003432879:

Variant ID: vg1003432879 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3432879
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TAATAGACTGAAGCATCTAGTAGAAATTAAACCTGCAAATTTACTGATTGAGTGTCGTCCGCACTAACTATTACTGCACCCGTCTTTGGTAGTCGCTTTG[G/T]
CTTTTTACGTGTAATGTTTGACTATTTGTCTTATTTAAAAAATTAGTATATATAAAAAAAGATAAGTCATACTTAAAGTATTTTGATAATAAAACAAATC

Reverse complement sequence

GATTTGTTTTATTATCAAAATACTTTAAGTATGACTTATCTTTTTTTATATATACTAATTTTTTAAATAAGACAAATAGTCAAACATTACACGTAAAAAG[C/A]
CAAAGCGACTACCAAAGACGGGTGCAGTAATAGTTAGTGCGGACGACACTCAATCAGTAAATTTGCAGGTTTAATTTCTACTAGATGCTTCAGTCTATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.20% 0.42% 0.13% NA
All Indica  2759 43.90% 55.40% 0.51% 0.22% NA
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 16.40% 83.60% 0.00% 0.00% NA
Indica I  595 46.90% 52.80% 0.34% 0.00% NA
Indica II  465 25.60% 72.70% 1.29% 0.43% NA
Indica III  913 59.40% 40.10% 0.33% 0.22% NA
Indica Intermediate  786 34.50% 64.90% 0.38% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 64.40% 32.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003432879 G -> T LOC_Os10g06610.1 downstream_gene_variant ; 369.0bp to feature; MODIFIER silent_mutation Average:55.069; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg1003432879 G -> T LOC_Os10g06620.1 downstream_gene_variant ; 1387.0bp to feature; MODIFIER silent_mutation Average:55.069; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg1003432879 G -> T LOC_Os10g06610-LOC_Os10g06620 intergenic_region ; MODIFIER silent_mutation Average:55.069; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N
vg1003432879 G -> DEL N N silent_mutation Average:55.069; most accessible tissue: Zhenshan97 root, score: 66.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003432879 NA 2.38E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 2.36E-12 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 7.94E-14 3.94E-15 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 1.53E-22 2.60E-15 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 8.37E-20 9.72E-26 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 1.31E-36 4.29E-42 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 1.65E-35 4.13E-61 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 1.02E-12 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 2.36E-16 5.03E-22 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 2.09E-20 1.27E-16 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 4.04E-23 7.71E-32 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 NA 1.43E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 1.56E-52 4.53E-68 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003432879 9.08E-43 1.29E-98 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251