\
| Variant ID: vg1003424866 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3424866 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, C: 0.22, others allele: 0.00, population size: 268. )
TACACTTATCTCCAAGGCACTATAAGGTAACACCAAAAGGCCATCTCTTCTAAAAGCACAATTCATATTAAGAATTTGAAATAACAATGGACCTTAAAAT[G/C]
GCTATTTATAGTTAACACACATGTGTGCTGGTGCACGCACACTGTTATGTGGGGGACCACGTATAGCAAGCACAGGAAACCAGGTGCACTGGACACACCG
CGGTGTGTCCAGTGCACCTGGTTTCCTGTGCTTGCTATACGTGGTCCCCCACATAACAGTGTGCGTGCACCAGCACACATGTGTGTTAACTATAAATAGC[C/G]
ATTTTAAGGTCCATTGTTATTTCAAATTCTTAATATGAATTGTGCTTTTAGAAGAGATGGCCTTTTGGTGTTACCTTATAGTGCCTTGGAGATAAGTGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 40.10% | 0.21% | 0.21% | NA |
| All Indica | 2759 | 43.50% | 55.90% | 0.29% | 0.36% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.70% | 52.80% | 0.34% | 0.17% | NA |
| Indica II | 465 | 25.60% | 73.30% | 0.43% | 0.65% | NA |
| Indica III | 913 | 58.80% | 40.40% | 0.33% | 0.44% | NA |
| Indica Intermediate | 786 | 33.70% | 65.90% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 58.30% | 41.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003424866 | G -> C | LOC_Os10g06610.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.444; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg1003424866 | G -> DEL | N | N | silent_mutation | Average:55.444; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003424866 | NA | 1.10E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 4.21E-12 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 2.37E-12 | 3.69E-14 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 1.83E-19 | 2.57E-13 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 1.93E-18 | 7.09E-25 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 1.51E-36 | 1.81E-46 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 6.85E-42 | 2.61E-66 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | NA | 8.78E-07 | mr1129_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 3.54E-11 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 4.44E-15 | 1.82E-20 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 7.45E-21 | 1.72E-19 | mr1547_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 2.74E-23 | 1.16E-31 | mr1547_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 2.84E-61 | 8.11E-74 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003424866 | 7.73E-61 | 4.09E-108 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |