\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003424037:

Variant ID: vg1003424037 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3424037
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.91, G: 0.09, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTATCACTCATAGTACTTTAAGTGTGATTTATATCTTATACATTTGCATAAAATTTTTGAATAAGACTAATGGTCAAACATGTGAGAAAAAGTCAACA[G/A]
CGTCATCTATTAAAAAACGGAGGTAGTATGTTTTTATAAAGAGCAACTTCTGGTTTCTACTCGTATATATAAGCGTTGTTGTTGATATCATCTTTCCTGT

Reverse complement sequence

ACAGGAAAGATGATATCAACAACAACGCTTATATATACGAGTAGAAACCAGAAGTTGCTCTTTATAAAAACATACTACCTCCGTTTTTTAATAGATGACG[C/T]
TGTTGACTTTTTCTCACATGTTTGACCATTAGTCTTATTCAAAAATTTTATGCAAATGTATAAGATATAAATCACACTTAAAGTACTATGAGTGATAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 31.70% 0.38% 0.02% NA
All Indica  2759 60.50% 38.90% 0.58% 0.04% NA
All Japonica  1512 75.80% 24.10% 0.07% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 53.60% 45.40% 0.84% 0.17% NA
Indica II  465 74.60% 24.30% 1.08% 0.00% NA
Indica III  913 50.10% 49.50% 0.44% 0.00% NA
Indica Intermediate  786 69.50% 30.30% 0.25% 0.00% NA
Temperate Japonica  767 61.50% 38.30% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003424037 G -> A LOC_Os10g06610.1 upstream_gene_variant ; 63.0bp to feature; MODIFIER silent_mutation Average:34.686; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg1003424037 G -> A LOC_Os10g06600-LOC_Os10g06610 intergenic_region ; MODIFIER silent_mutation Average:34.686; most accessible tissue: Minghui63 root, score: 67.149 N N N N
vg1003424037 G -> DEL N N silent_mutation Average:34.686; most accessible tissue: Minghui63 root, score: 67.149 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003424037 NA 3.06E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 6.20E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 4.09E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 2.16E-08 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 1.68E-12 5.49E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 8.08E-09 8.72E-12 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 9.75E-17 1.36E-22 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 2.43E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 5.82E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 1.10E-22 8.05E-34 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 4.60E-41 3.34E-64 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 7.34E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 8.95E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 NA 1.20E-06 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 1.86E-07 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 1.15E-15 2.30E-22 mr1538_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 3.70E-11 3.81E-15 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 2.57E-21 6.03E-30 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 7.72E-26 5.03E-44 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 6.45E-58 2.76E-98 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003424037 2.40E-11 4.03E-18 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251