\
| Variant ID: vg1003411947 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 3411947 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 218. )
TTTGTCAATGTCACACTCTGATCGCTGACAAACAAGAAAAGTAGAAAACTGGATTTCTCTAGTGGATTTGCTTTTTTGAGAAAAAAAATACCATCGTATT[A/G]
TCTCAAATTTAGGATTATAGTAAATGATCACCTTTCAATTTCAATATATTGTTATTTTCCAATTCCAGTGTTCTGAATTGTGGATAGTGCTCCTGTTGCA
TGCAACAGGAGCACTATCCACAATTCAGAACACTGGAATTGGAAAATAACAATATATTGAAATTGAAAGGTGATCATTTACTATAATCCTAAATTTGAGA[T/C]
AATACGATGGTATTTTTTTTCTCAAAAAAGCAAATCCACTAGAGAAATCCAGTTTTCTACTTTTCTTGTTTGTCAGCGATCAGAGTGTGACATTGACAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 38.40% | 0.40% | 0.00% | NA |
| All Indica | 2759 | 43.80% | 55.70% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 46.60% | 52.90% | 0.50% | 0.00% | NA |
| Indica II | 465 | 25.80% | 73.30% | 0.86% | 0.00% | NA |
| Indica III | 913 | 59.50% | 40.10% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 34.20% | 65.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 31.10% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1003411947 | A -> G | LOC_Os10g06600-LOC_Os10g06610 | intergenic_region ; MODIFIER | silent_mutation | Average:37.918; most accessible tissue: Callus, score: 72.359 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1003411947 | NA | 9.99E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 6.68E-12 | NA | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 4.55E-13 | 1.06E-14 | mr1538 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 9.09E-22 | 1.32E-14 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 2.76E-19 | 1.09E-25 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 1.11E-41 | 4.77E-44 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 5.03E-42 | 7.18E-67 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | NA | 4.18E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 2.02E-12 | NA | mr1538_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 2.17E-15 | 2.56E-21 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 3.40E-20 | 2.31E-16 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 5.22E-23 | 7.13E-32 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | NA | 1.97E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 3.72E-68 | 9.52E-70 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1003411947 | 9.60E-62 | 4.78E-109 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |