Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1003411947:

Variant ID: vg1003411947 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3411947
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGTCAATGTCACACTCTGATCGCTGACAAACAAGAAAAGTAGAAAACTGGATTTCTCTAGTGGATTTGCTTTTTTGAGAAAAAAAATACCATCGTATT[A/G]
TCTCAAATTTAGGATTATAGTAAATGATCACCTTTCAATTTCAATATATTGTTATTTTCCAATTCCAGTGTTCTGAATTGTGGATAGTGCTCCTGTTGCA

Reverse complement sequence

TGCAACAGGAGCACTATCCACAATTCAGAACACTGGAATTGGAAAATAACAATATATTGAAATTGAAAGGTGATCATTTACTATAATCCTAAATTTGAGA[T/C]
AATACGATGGTATTTTTTTTCTCAAAAAAGCAAATCCACTAGAGAAATCCAGTTTTCTACTTTTCTTGTTTGTCAGCGATCAGAGTGTGACATTGACAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.20%	38.40%	0.40%	0.00%	NA
All Indica	2759	43.80%	55.70%	0.51%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.07%	0.00%	NA
Aus	269	15.60%	84.40%	0.00%	0.00%	NA
Indica I	595	46.60%	52.90%	0.50%	0.00%	NA
Indica II	465	25.80%	73.30%	0.86%	0.00%	NA
Indica III	913	59.50%	40.10%	0.44%	0.00%	NA
Indica Intermediate	786	34.20%	65.40%	0.38%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	64.40%	31.10%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003411947	A -> G	LOC_Os10g06600-LOC_Os10g06610	intergenic_region ; MODIFIER	silent_mutation	Average:37.918; most accessible tissue: Callus, score: 72.359	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003411947	NA	9.99E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	6.68E-12	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	4.55E-13	1.06E-14	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	9.09E-22	1.32E-14	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	2.76E-19	1.09E-25	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	1.11E-41	4.77E-44	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	5.03E-42	7.18E-67	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	NA	4.18E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	2.02E-12	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	2.17E-15	2.56E-21	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	3.40E-20	2.31E-16	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	5.22E-23	7.13E-32	mr1547_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	NA	1.97E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	3.72E-68	9.52E-70	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947	9.60E-62	4.78E-109	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251