\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003411947:

Variant ID: vg1003411947 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3411947
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTCAATGTCACACTCTGATCGCTGACAAACAAGAAAAGTAGAAAACTGGATTTCTCTAGTGGATTTGCTTTTTTGAGAAAAAAAATACCATCGTATT[A/G]
TCTCAAATTTAGGATTATAGTAAATGATCACCTTTCAATTTCAATATATTGTTATTTTCCAATTCCAGTGTTCTGAATTGTGGATAGTGCTCCTGTTGCA

Reverse complement sequence

TGCAACAGGAGCACTATCCACAATTCAGAACACTGGAATTGGAAAATAACAATATATTGAAATTGAAAGGTGATCATTTACTATAATCCTAAATTTGAGA[T/C]
AATACGATGGTATTTTTTTTCTCAAAAAAGCAAATCCACTAGAGAAATCCAGTTTTCTACTTTTCTTGTTTGTCAGCGATCAGAGTGTGACATTGACAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.40% 0.40% 0.00% NA
All Indica  2759 43.80% 55.70% 0.51% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 46.60% 52.90% 0.50% 0.00% NA
Indica II  465 25.80% 73.30% 0.86% 0.00% NA
Indica III  913 59.50% 40.10% 0.44% 0.00% NA
Indica Intermediate  786 34.20% 65.40% 0.38% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 31.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003411947 A -> G LOC_Os10g06600-LOC_Os10g06610 intergenic_region ; MODIFIER silent_mutation Average:37.918; most accessible tissue: Callus, score: 72.359 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003411947 NA 9.99E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 6.68E-12 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 4.55E-13 1.06E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 9.09E-22 1.32E-14 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 2.76E-19 1.09E-25 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 1.11E-41 4.77E-44 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 5.03E-42 7.18E-67 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 NA 4.18E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 2.02E-12 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 2.17E-15 2.56E-21 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 3.40E-20 2.31E-16 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 5.22E-23 7.13E-32 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 NA 1.97E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 3.72E-68 9.52E-70 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003411947 9.60E-62 4.78E-109 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251