\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003402306:

Variant ID: vg1003402306 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3402306
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCAAGTGTTACAGCGAGACGAAAAATTTTGGCGTGTCATATCGGATATATGGACACACATTTGAAGTATTAAACGTAGATTAATAACAAAATAAATTA[C/T]
AGATTCCGTCTGTAAATTGCGAGACAAATTTAGAGCCTCCCCATTCCGCTCGTCAGCCTCCCCACCTCCTTCCTCTCTGTGTGTGTGCTCGCCGGCCTCC

Reverse complement sequence

GGAGGCCGGCGAGCACACACACAGAGAGGAAGGAGGTGGGGAGGCTGACGAGCGGAATGGGGAGGCTCTAAATTTGTCTCGCAATTTACAGACGGAATCT[G/A]
TAATTTATTTTGTTATTAATCTACGTTTAATACTTCAAATGTGTGTCCATATATCCGATATGACACGCCAAAATTTTTCGTCTCGCTGTAACACTTGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.30% 0.08% 0.21% NA
All Indica  2759 43.40% 56.10% 0.14% 0.33% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 46.90% 52.40% 0.34% 0.34% NA
Indica II  465 25.60% 73.50% 0.00% 0.86% NA
Indica III  913 58.80% 40.90% 0.11% 0.22% NA
Indica Intermediate  786 33.30% 66.40% 0.13% 0.13% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 58.30% 41.70% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003402306 C -> T LOC_Os10g06600.1 upstream_gene_variant ; 4070.0bp to feature; MODIFIER silent_mutation Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1003402306 C -> T LOC_Os10g06600-LOC_Os10g06610 intergenic_region ; MODIFIER silent_mutation Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg1003402306 C -> DEL N N silent_mutation Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003402306 NA 9.84E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 6.81E-12 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 2.92E-12 4.61E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 5.20E-20 1.13E-13 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 2.32E-19 6.44E-26 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 1.70E-36 8.83E-47 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 5.45E-39 5.91E-64 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 NA 4.53E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 2.64E-11 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 8.04E-15 1.26E-19 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 1.02E-20 2.61E-19 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 8.88E-24 7.32E-32 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 1.72E-52 3.82E-72 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306 8.14E-48 1.55E-103 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251