Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003402306:

Variant ID: vg1003402306 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 3402306
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCAAGTGTTACAGCGAGACGAAAAATTTTGGCGTGTCATATCGGATATATGGACACACATTTGAAGTATTAAACGTAGATTAATAACAAAATAAATTA[C/T]
AGATTCCGTCTGTAAATTGCGAGACAAATTTAGAGCCTCCCCATTCCGCTCGTCAGCCTCCCCACCTCCTTCCTCTCTGTGTGTGTGCTCGCCGGCCTCC

Reverse complement sequence

GGAGGCCGGCGAGCACACACACAGAGAGGAAGGAGGTGGGGAGGCTGACGAGCGGAATGGGGAGGCTCTAAATTTGTCTCGCAATTTACAGACGGAATCT[G/A]
TAATTTATTTTGTTATTAATCTACGTTTAATACTTCAAATGTGTGTCCATATATCCGATATGACACGCCAAAATTTTTCGTCTCGCTGTAACACTTGGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	40.30%	0.08%	0.21%	NA
All Indica	2759	43.40%	56.10%	0.14%	0.33%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	7.10%	92.90%	0.00%	0.00%	NA
Indica I	595	46.90%	52.40%	0.34%	0.34%	NA
Indica II	465	25.60%	73.50%	0.00%	0.86%	NA
Indica III	913	58.80%	40.90%	0.11%	0.22%	NA
Indica Intermediate	786	33.30%	66.40%	0.13%	0.13%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	58.30%	41.70%	0.00%	0.00%	NA
Intermediate	90	55.60%	43.30%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1003402306	C -> T	LOC_Os10g06600.1	upstream_gene_variant ; 4070.0bp to feature; MODIFIER	silent_mutation	Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1003402306	C -> T	LOC_Os10g06600-LOC_Os10g06610	intergenic_region ; MODIFIER	silent_mutation	Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg1003402306	C -> DEL	N	N	silent_mutation	Average:65.169; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1003402306	NA	9.84E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	6.81E-12	NA	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	2.92E-12	4.61E-14	mr1538	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	5.20E-20	1.13E-13	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	2.32E-19	6.44E-26	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	1.70E-36	8.83E-47	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	5.45E-39	5.91E-64	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	NA	4.53E-07	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	2.64E-11	NA	mr1538_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	8.04E-15	1.26E-19	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	1.02E-20	2.61E-19	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	8.88E-24	7.32E-32	mr1547_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	1.72E-52	3.82E-72	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003402306	8.14E-48	1.55E-103	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251