\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1003401168:

Variant ID: vg1003401168 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 3401168
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTAGAAACCGGCACCTTTGACGATCCACGAATCCTGATGCATCGAGTCAACTCCATCGAAATCATCACGAAAATCATCCAAACACAATAACAAAAAT[C/T]
GATTCCCCTACCTTCCCATCGTTGATCTAGCTGCCCCCACCATCATGGCAGCCAGCGGCGGAGAGGAGGCGCCTTCCCTCTTGCTGGCACTGCCACTGCC

Reverse complement sequence

GGCAGTGGCAGTGCCAGCAAGAGGGAAGGCGCCTCCTCTCCGCCGCTGGCTGCCATGATGGTGGGGGCAGCTAGATCAACGATGGGAAGGTAGGGGAATC[G/A]
ATTTTTGTTATTGTGTTTGGATGATTTTCGTGATGATTTCGATGGAGTTGACTCGATGCATCAGGATTCGTGGATCGTCAAAGGTGCCGGTTTCTAAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.60% 0.34% 0.00% NA
All Indica  2759 43.60% 55.90% 0.54% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.07% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 46.20% 53.10% 0.67% 0.00% NA
Indica II  465 25.60% 73.30% 1.08% 0.00% NA
Indica III  913 59.30% 40.40% 0.33% 0.00% NA
Indica Intermediate  786 34.10% 65.50% 0.38% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1003401168 C -> T LOC_Os10g06600.1 upstream_gene_variant ; 2932.0bp to feature; MODIFIER silent_mutation Average:73.146; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N
vg1003401168 C -> T LOC_Os10g06600-LOC_Os10g06610 intergenic_region ; MODIFIER silent_mutation Average:73.146; most accessible tissue: Minghui63 panicle, score: 87.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1003401168 8.96E-06 8.96E-06 mr1027 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 NA 1.58E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 1.29E-11 NA mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 6.37E-13 2.13E-14 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 2.74E-21 1.78E-14 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 7.20E-19 2.94E-25 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 2.03E-43 1.70E-45 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 5.13E-44 5.85E-70 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 NA 3.83E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 NA 6.60E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 7.97E-12 NA mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 4.67E-15 2.24E-20 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 1.39E-19 5.13E-16 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 1.83E-22 7.99E-31 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 NA 4.21E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 4.13E-74 8.25E-73 mr1709_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1003401168 1.73E-68 2.64E-118 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251